G269999



Basic Information


Item Value
gene id G269999
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 4500293 ~ 4505119 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU306384
TCTAGTAGACCCCAAAAACAAAATCAAGACTCTGTTATCTAGTATGACCTCTTTAATGAAATAACGATCATTATGCATAATGTGGAAAGGATGCTATAAATAATTTTAAATCAGAAATAAACAGGAGATGGAACTTAAGTGACTTACGCTTTTAACTCAGCAAATCTGACCAGCATCTTGGCATAGCTCTCATTCTGACTGTACTTCCCCAACGGCATGCTGGAAAAGACACGCGTGTAGCAGTCGATGAGCTTCGTGAGAAGACTGGGATCCGTTTGGGGATTGCCTTTCTTCTCCAGATTGGTCAGAAATGTCCGGCAGGTGTCAGGTGAGTTTGAACTGATGGCCTGATTGATGTAATCCGTGTCATCATCATTGAATAATCGCTTCATCTTGGCCAGCCGTTGACACAACATGGCAATCTGCATCTGTCGCTCTGTACTCTCTTCTTCATCCATCTCTGCACAACTGAGACGGAGAAAGGATGTAAATCTGAGGGTGTGATCGGCTAAATGTTTTGTTCACCAACCGTTTCAAAATTCGACACTTCCCCGGAGCGCGCGCTCCTGTTGGTCAGTTTGTATTTCACGTGACCATTTCACAGTCGGGTGGGCGGGGCTTTCCTGCCACGTCATACTTTCATTCTTCGCTCGTTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU306384 True 656 lncRNA 0.45 3 4500293 4505119
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000065_04361047_04363753 NA coding upstream 136454 4360937 ~ 4363839 (+)
CI01000065_04277095_04282609 NA coding upstream 217094 4276008 ~ 4283199 (+)
CI01000065_04247989_04251347 FAM46A.L, FAM46AB, FAM46A, FAM46AA coding upstream 248496 4245663 ~ 4251797 (+)
CI01000065_04183838_04222038 NA coding upstream 277826 4183838 ~ 4222467 (+)
CI01000065_04115052_04165049 NA coding upstream 334864 4112278 ~ 4165429 (+)
CI01000065_04520939_04539169 ELOVL4, ELOVL4A coding downstream 15729 4520848 ~ 4539261 (+)
CI01000065_04547859_04555579 SOGA3 coding downstream 42740 4547859 ~ 4555579 (+)
CI01000065_04561164_04574594 NA coding downstream 55999 4561118 ~ 4574656 (+)
CI01000065_04578385_04586426 ECHDC1 coding downstream 72721 4577840 ~ 4586454 (+)
CI01000065_04672707_04680741 NA coding downstream 167520 4672639 ~ 4681582 (+)
G269967 NA non-coding upstream 120791 4376057 ~ 4379502 (+)
G269966 NA non-coding upstream 129099 4370806 ~ 4371194 (+)
G269965 NA non-coding upstream 129530 4370496 ~ 4370763 (+)
G269963 NA non-coding upstream 136045 4363954 ~ 4364248 (+)
G269959 NA non-coding upstream 150863 4349110 ~ 4349430 (+)
G270001 NA non-coding downstream 10635 4515754 ~ 4526214 (+)
G270090 NA non-coding downstream 204890 4710009 ~ 4714110 (+)
G270054 NA non-coding downstream 277750 4782869 ~ 4784552 (+)
G270098 NA non-coding downstream 319668 4824787 ~ 4825329 (+)
G270100 NA non-coding downstream 323541 4828660 ~ 4828880 (+)
G269225 NA other upstream 947169 3552804 ~ 3553214 (+)
G269181 NA other upstream 1037365 3458957 ~ 3462928 (+)
G268805 NA other upstream 1862088 2608907 ~ 2638205 (+)
G268525 NA other upstream 2260295 2239159 ~ 2239998 (+)
G267577 NA other upstream 3417638 1082153 ~ 1082655 (+)

Expression


G269999 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G269999 Expression in each Bioproject

Bar chart with 38 bars.
G269999 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network