G270446


Basic Information

Item Value
gene id G270446
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000065
NCBI id null
chromosome length 4956624
location 4772198 ~ 4772418 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU306891
GGGCACGTGAGCATCAGAACTGGACCACGGAGCAATGGAAGAAGGTGGTCTGGTCTGATGAATCACGTTTTCTTTTACATCACGTGGATGGTCGGGTGCGTGTGCGTCGCTTACCTGGGGAACACATGGCACCAGGATGCACTATGGGAAGAAGGCAAGCCGGCGGAGGAAGTGTGATGCTTTGGGCAATGTTCTGCTGGGAAACCCTGGGTCCTGCCATC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU306891 True 221 lncRNA 0.56 1 4772198 4772418

Neighbor

gene id symbol gene type direction distance location
CI01000065_04705952_04710430 NA coding downstream 61610 4705899 ~ 4710588 (-)
CI01000065_04657955_04662886 NA coding downstream 109091 4657609 ~ 4663107 (-)
CI01000065_04507862_04513517 DCTN3 coding downstream 258681 4507862 ~ 4513517 (-)
CI01000065_04484009_04501087 TTK coding downstream 271111 4484009 ~ 4501087 (-)
CI01000065_04470763_04478735 NA coding downstream 293090 4469999 ~ 4479108 (-)
CI01000065_04876578_04886460 NA coding upstream 103361 4875779 ~ 4887207 (-)
CI01000065_04939969_04941719 NDUFA3 coding upstream 167477 4939890 ~ 4941766 (-)
CI01000065_04948358_04950696 MRPL51 coding upstream 175485 4947903 ~ 4950826 (-)
CI01000065_04953684_04953866 NA coding upstream 180763 4953181 ~ 4954390 (-)
G270445 NA non-coding downstream 599 4771369 ~ 4771599 (-)
G270444 NA non-coding downstream 3959 4767962 ~ 4768239 (-)
G270442 NA non-coding downstream 7594 4764082 ~ 4764604 (-)
G270404 NA non-coding downstream 116919 4653695 ~ 4655279 (-)
G270448 NA non-coding upstream 2448 4774866 ~ 4775070 (-)
G270454 NA non-coding upstream 17754 4790172 ~ 4794866 (-)
G270465 NA non-coding upstream 31576 4803994 ~ 4804654 (-)
G270469 NA non-coding upstream 51117 4823535 ~ 4823782 (-)
G270366 NA non-coding upstream 96323 4868741 ~ 4870260 (-)
CI01000065_03794501_03806693 VEGFAA, VEGFA other downstream 961955 3793123 ~ 3806693 (-)
G269679 NA other downstream 997904 3773880 ~ 3774294 (-)
G269348 NA other downstream 1459718 3304357 ~ 3312480 (-)
CI01000065_00782736_00793467 NT5C3A, NT5C3 other downstream 3988537 782697 ~ 793467 (-)
CI01000065_00622545_00624625 NA other downstream 4147541 622123 ~ 624657 (-)

Expression


Co-expression Network