G271802


Basic Information

Item Value
gene id G271802
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000066
NCBI id null
chromosome length 3719324
location 540367 ~ 566360 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU308455
CCCTCTCTCTCACGTAAGCCCTCCCTTGTGTTTTTCCAGCCGAGCTCTTTCTGTGAAAAACAATTAGACTAAAACTGCTCAATACCCAAGGTCCTCCGAACGCTTCTTTTTAAATAGAGCCGTCAAGGTGACTTTTCTCCAAACACCCACTGCTTCTGTTTTTTCTCTCTTCTCCTCCTCCTCTCTTTCTCTCTCTCTCACTCTGTCTTTCACACACACTCGCTCATCGTTTTCCTCTCACGCTGTTATTTCCCACTGAGCAGACCATGTCCGATCAGAACACCTTTTTCTTATGGAACACGCTGCAAACGCAGTAACAGTGTGTGTTGTCCCTGCGAGAACAAACCCATGATTCCCTAAAGTGTGTTGGACACAGACAGCAGGGCAGCACACACACACACACACAGACACACAGACACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU308455 True 420 lncRNA 0.47 2 540367 566360

Neighbor

gene id symbol gene type direction distance location
CI01000066_00438633_00446467 NA coding downstream 93666 438001 ~ 446701 (-)
CI01000066_00409321_00410208 NA coding downstream 129514 409022 ~ 410853 (-)
CI01000066_00250654_00271679 NA coding downstream 268462 250604 ~ 271905 (-)
CI01000066_00196094_00242947 WNK1B, WNK1 coding downstream 295139 195852 ~ 245228 (-)
CI01000066_00179779_00180183 NA coding downstream 360078 179721 ~ 180289 (-)
CI01000066_00597946_00601637 FBXL13, FBXL14B, FBXL14, FBXL14.S, FBXL14A coding upstream 31350 597710 ~ 601637 (-)
CI01000066_00642830_00643160 NA coding upstream 76158 642518 ~ 643249 (-)
CI01000066_00675433_00675726 NA coding upstream 108521 674881 ~ 676211 (-)
CI01000066_00679999_00685380 NA coding upstream 113292 679652 ~ 685380 (-)
CI01000066_00711133_00728657 TTLL12 coding upstream 144773 711133 ~ 728657 (-)
G271620 NA non-coding downstream 19417 518309 ~ 520950 (-)
G271745 NA non-coding downstream 83957 455635 ~ 456410 (-)
G271623 NA non-coding downstream 238647 300957 ~ 301720 (-)
G271614 NA non-coding downstream 263102 277033 ~ 277265 (-)
G271583 NA non-coding downstream 352488 186928 ~ 187879 (-)
G271818 NA non-coding upstream 1921 568281 ~ 569175 (-)
G271788 NA non-coding upstream 53347 619707 ~ 623728 (-)
G271838 NA non-coding upstream 61901 628261 ~ 629754 (-)
G271774 NA non-coding upstream 83099 649459 ~ 662102 (-)
G271849 NA non-coding upstream 88640 655000 ~ 656203 (-)
CI01000066_01823227_01826380 NA other upstream 1256669 1823029 ~ 1826817 (-)
CI01000066_01843043_01848783 NA other upstream 1275319 1842554 ~ 1849466 (-)
G272221 NA other upstream 1392742 1959102 ~ 1985228 (-)

Expression


Co-expression Network