G271838


Basic Information

Item Value
gene id G271838
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000066
NCBI id null
chromosome length 3719324
location 628261 ~ 629754 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU308493
CGGAGACGGCAAACAACCATCCCTGGAGGTGTAGAGATAAGAGACGCGGGACGGGAAAAAGAGTCTAAATTGATTTCTAATGAAAGACACACAGAAGCAGGTGATCTTTATAGAGGGTGGAGGCCTCCTCTTTCTGTACAGTCTGGGTCACGAGCCTTTGTGACCCACAGCACCGGAACCACACGCACCATCTTTCACTACACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU308493 True 204 lncRNA 0.50 2 628261 629754

Neighbor

gene id symbol gene type direction distance location
CI01000066_00597946_00601637 FBXL13, FBXL14B, FBXL14, FBXL14.S, FBXL14A coding downstream 26624 597710 ~ 601637 (-)
CI01000066_00535081_00543543 NA coding downstream 84344 534908 ~ 543917 (-)
CI01000066_00438633_00446467 NA coding downstream 181560 438001 ~ 446701 (-)
CI01000066_00409321_00410208 NA coding downstream 217408 409022 ~ 410853 (-)
CI01000066_00250654_00271679 NA coding downstream 356356 250604 ~ 271905 (-)
CI01000066_00642830_00643160 NA coding upstream 12764 642518 ~ 643249 (-)
CI01000066_00675433_00675726 NA coding upstream 45127 674881 ~ 676211 (-)
CI01000066_00679999_00685380 NA coding upstream 49898 679652 ~ 685380 (-)
CI01000066_00711133_00728657 TTLL12 coding upstream 81379 711133 ~ 728657 (-)
CI01000066_00730057_00737661 PNPLA3 coding upstream 99961 729715 ~ 737661 (-)
G271788 NA non-coding downstream 4533 619707 ~ 623728 (-)
G271818 NA non-coding downstream 59086 568281 ~ 569175 (-)
G271802 NA non-coding downstream 61901 540367 ~ 566360 (-)
G271620 NA non-coding downstream 107311 518309 ~ 520950 (-)
G271745 NA non-coding downstream 171851 455635 ~ 456410 (-)
G271774 NA non-coding upstream 19705 649459 ~ 662102 (-)
G271849 NA non-coding upstream 25246 655000 ~ 656203 (-)
G271772 NA non-coding upstream 34783 664537 ~ 666836 (-)
G271786 NA non-coding upstream 116182 745936 ~ 752890 (-)
CI01000066_00938534_00939532 NA non-coding upstream 307802 937351 ~ 939532 (-)
CI01000066_01823227_01826380 NA other upstream 1193275 1823029 ~ 1826817 (-)
CI01000066_01843043_01848783 NA other upstream 1211925 1842554 ~ 1849466 (-)
G272221 NA other upstream 1329348 1959102 ~ 1985228 (-)

Expression


Co-expression Network