G270675


Basic Information

Item Value
gene id G270675
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000066
NCBI id null
chromosome length 3719324
location 755058 ~ 755386 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU307173
TAATATTTCTGTTGTTTTATTTTTGCAATAATGAAATATAAAATGAATTCCTATGTACTGCATAACAAAACAAACTGCAAACAGATATTGGAAGCAAAAAACATAGGCTACCTAATATAATATAAGCTAAGCTAGCAGGCTAATCGGGTAGATGTATGCTATGCTAGTACATAAGCTGACTACAAAAACAGTAAGAACAAGAAATGCTTGATTTCACAACCTATAGCTTCAGTTATATACTAGTATATGAACCATGTAATTTAAAAGACATTAATGGTCATTATAACGCATTTTAAATGATATAAATCATAACAATATTTTGCAGGAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU307173 True 329 lncRNA 0.28 1 755058 755386

Neighbor

gene id symbol gene type direction distance location
CI01000066_00738687_00750408 MGC115026, ST4A1, SULT4A1, SULT4A1.L coding upstream 4318 738687 ~ 750740 (+)
CI01000066_00661106_00665703 ADIPOR2, MGC85478 coding upstream 89143 661106 ~ 665915 (+)
CI01000066_00620105_00632826 WNT5B coding upstream 122232 620105 ~ 632826 (+)
CI01000066_00549586_00551630 NA coding upstream 203323 549361 ~ 551735 (+)
CI01000066_00512961_00520396 NA coding upstream 234517 512272 ~ 520541 (+)
CI01000066_00915548_00922666 SAMM50L, SAMM50 coding downstream 160162 915548 ~ 923234 (+)
CI01000066_00925751_00935641 ALDH1L2 coding downstream 170365 925751 ~ 935852 (+)
CI01000066_00941480_00966469 SLC41A2B coding downstream 186094 941480 ~ 966471 (+)
CI01000066_01015249_01016975 NA coding downstream 258383 1013769 ~ 1017334 (+)
CI01000066_01021163_01021546 NA coding downstream 265301 1020687 ~ 1022630 (+)
G270646 NA non-coding upstream 76956 673828 ~ 678102 (+)
G270650 NA non-coding upstream 83633 671193 ~ 671425 (+)
G270648 NA non-coding upstream 111108 637481 ~ 643950 (+)
G270625 NA non-coding upstream 177854 569177 ~ 577204 (+)
G270633 NA non-coding upstream 220551 534277 ~ 534507 (+)
G270695 NA non-coding downstream 31863 787249 ~ 828540 (+)
G270803 NA non-coding downstream 252660 1008046 ~ 1008810 (+)
G270801 NA non-coding downstream 301623 1057009 ~ 1058689 (+)
G270827 NA non-coding downstream 304129 1059515 ~ 1059734 (+)
G270546 NA other upstream 568381 184528 ~ 186677 (+)
CI01000066_00019553_00029834 PAHX, PHYH other upstream 734785 19447 ~ 30531 (+)
G270973 NA other downstream 1089066 1844452 ~ 1847752 (+)
CI01000066_02274624_02277624 NA other downstream 1513783 2274557 ~ 2278119 (+)
CI01000066_02296138_02305439 CMAH other downstream 1546824 2296071 ~ 2305637 (+)
G271105 NA other downstream 1675324 2430710 ~ 2439169 (+)

Expression


Co-expression Network