G270877


Basic Information

Item Value
gene id G270877
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000066
NCBI id null
chromosome length 3719324
location 1399573 ~ 1399784 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU307408
GCATTAGCATCACGTGACCTCAGGTTTCTTCTACCGCAGTTGGGTTTTTGCGTTTCTCTGTGCCGTTGCATTGGCTGGATCAAACAGATGATTTGTCCACAGTTGGACGTGGAAACCGATATCAACAATATCGACAACCAGCTGTGCTGCTCTAGCTTCAGTATTCCTGGCATTCTGCCACACGCTGTAAATCAATGCGGATCATACAGGGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU307408 True 212 lncRNA 0.48 1 1399573 1399784

Neighbor

gene id symbol gene type direction distance location
CI01000066_01358866_01360100 NDUFA5 coding upstream 39080 1358866 ~ 1360493 (+)
CI01000066_01339972_01347463 HSPA14 coding upstream 52110 1339972 ~ 1347463 (+)
CI01000066_01334756_01335057 NA coding upstream 64047 1334756 ~ 1335526 (+)
CI01000066_01245954_01257380 NA coding upstream 142193 1245954 ~ 1257380 (+)
CI01000066_01236972_01244870 NA coding upstream 154461 1236972 ~ 1245112 (+)
CI01000066_01433027_01434982 NA coding downstream 33243 1433027 ~ 1435523 (+)
CI01000066_01435756_01447201 NA coding downstream 35972 1435756 ~ 1448712 (+)
CI01000066_01453501_01454593 SSBP1 coding downstream 53717 1453501 ~ 1454967 (+)
CI01000066_01468657_01476221 CREB3L2 coding downstream 68873 1468657 ~ 1476254 (+)
CI01000066_01479854_01525318 DGKI coding downstream 80070 1479854 ~ 1525318 (+)
G270864 NA non-coding upstream 44183 1354115 ~ 1355390 (+)
G270855 NA non-coding upstream 75548 1323495 ~ 1324025 (+)
G270831 NA non-coding upstream 324867 1074219 ~ 1074706 (+)
G270827 NA non-coding upstream 339839 1059515 ~ 1059734 (+)
G270801 NA non-coding upstream 340884 1057009 ~ 1058689 (+)
G270720 NA non-coding downstream 4991 1404775 ~ 1408011 (+)
G270902 NA non-coding downstream 273630 1673414 ~ 1687198 (+)
G270901 NA non-coding downstream 290346 1690130 ~ 1698632 (+)
G270931 NA non-coding downstream 325819 1725603 ~ 1727443 (+)
G270923 NA non-coding downstream 389812 1789596 ~ 1791364 (+)
G270546 NA other upstream 1212896 184528 ~ 186677 (+)
CI01000066_00019553_00029834 PAHX, PHYH other upstream 1379300 19447 ~ 30531 (+)
G270973 NA other downstream 444668 1844452 ~ 1847752 (+)
CI01000066_02274624_02277624 NA other downstream 869385 2274557 ~ 2278119 (+)
CI01000066_02296138_02305439 CMAH other downstream 902426 2296071 ~ 2305637 (+)
G271105 NA other downstream 1030926 2430710 ~ 2439169 (+)

Expression


Co-expression Network