G271054


Basic Information

Item Value
gene id G271054
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000066
NCBI id null
chromosome length 3719324
location 2162575 ~ 2162800 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU307624
GAATAAACTCACATATCATCTGTCATGCATCATGCATACTGTAGTGTCCTGCACGCATGAGTCTGTTCAAGGTCAAGCCGTTACTGTGGCTGCAAACTCTATTATTAATTCAAAACACATACATTTGTTTACCAATCACCAAACTCTAAGATGGCACTGTACTGAACTCATTTAAAGCCAGTAACTCTGAATGAATATGAATATATTACTGCTGACATGTTCTCCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU307624 True 226 lncRNA 0.38 1 2162575 2162800

Neighbor

gene id symbol gene type direction distance location
CI01000066_02144721_02147772 FRS2A, FRS2 coding upstream 13395 2144721 ~ 2149180 (+)
CI01000066_02124655_02126692 YEATS4 coding upstream 35712 2124655 ~ 2126863 (+)
CI01000066_02055967_02056270 NA coding upstream 106242 2055967 ~ 2056333 (+)
CI01000066_02011151_02031083 STRIP2 coding upstream 131457 2011151 ~ 2031118 (+)
CI01000066_01966833_01995697 AHCYL2.S, MGC79134, AHCYL2 coding upstream 166860 1966138 ~ 1995715 (+)
CI01000066_02274624_02277624 NA coding downstream 111757 2274557 ~ 2278119 (+)
CI01000066_02287451_02287819 NA coding downstream 124544 2287344 ~ 2288534 (+)
CI01000066_02296138_02305439 CMAH coding downstream 133271 2296071 ~ 2305637 (+)
CI01000066_02320093_02321778 NA coding downstream 157293 2320093 ~ 2322043 (+)
CI01000066_02330898_02340303 NA coding downstream 168098 2330898 ~ 2341338 (+)
G270985 NA non-coding upstream 2119 2150296 ~ 2160456 (+)
G270982 NA non-coding upstream 38869 2120288 ~ 2123706 (+)
G271051 NA non-coding upstream 53938 2108311 ~ 2108637 (+)
G271050 NA non-coding upstream 54333 2107991 ~ 2108242 (+)
G270996 NA non-coding upstream 96289 2062689 ~ 2066286 (+)
G271058 NA non-coding downstream 8163 2170963 ~ 2171281 (+)
G271063 NA non-coding downstream 15211 2178011 ~ 2178216 (+)
G271068 NA non-coding downstream 22586 2185386 ~ 2185629 (+)
G271085 NA non-coding downstream 89842 2252642 ~ 2252850 (+)
G271074 NA non-coding downstream 93979 2256779 ~ 2257258 (+)
G270973 NA other upstream 314823 1844452 ~ 1847752 (+)
G270546 NA other upstream 1975898 184528 ~ 186677 (+)
CI01000066_00019553_00029834 PAHX, PHYH other upstream 2142302 19447 ~ 30531 (+)
G271105 NA other downstream 267910 2430710 ~ 2439169 (+)
CI01000066_03211701_03215444 NA other downstream 1050204 3211701 ~ 3215446 (+)
CI01000066_03354136_03429399 GRM8A, GRM6, GRM8, GRM8B other downstream 1183993 3353662 ~ 3429516 (+)

Expression


Co-expression Network