G272626



Basic Information


Item Value
gene id G272626
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000066
NCBI id null
chromosome length 3719324
location 3602979 ~ 3603234 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU309398
AATCTGAGATAATGTGCTGTCAGTCAATGTGAGTTTAACATCACATCGCCAAAAGACCCGCTGTTCTATCACTGATATAGATTCATATTATCGCAAAATTACATCCGCAAGAGTCGAATAAACCCAGAGCTTTCACTGTAATGTGGCTGTTCGTCGCGTTCTGAGTAGCAGGTGTCAGAGATGAGCATGGAGATCATCATATCGGATCAGACTAATAAAAGTAACAGGCTTTATGGCAGATGATGTATGATGATTT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU309398 True 256 lncRNA 0.40 1 3602979 3603234

Neighbor


gene id symbol gene type direction distance location
CI01000066_03454386_03455995 NA coding downstream 146813 3454330 ~ 3456166 (-)
CI01000066_03439936_03446824 NA coding downstream 154121 3439679 ~ 3448858 (-)
CI01000066_03203296_03203476 NA coding downstream 399503 3203123 ~ 3203476 (-)
CI01000066_03158972_03165320 PIK3CG coding downstream 437659 3158316 ~ 3165320 (-)
CI01000066_03044933_03045997 NA coding downstream 556982 3044336 ~ 3045997 (-)
CI01000066_03649007_03654018 LMOD2 coding upstream 45698 3648932 ~ 3654018 (-)
CI01000066_03655461_03659325 ASB15B coding upstream 51598 3654832 ~ 3659717 (-)
CI01000066_03711890_03717941 PMPCB.L, PMPCB coding upstream 108215 3711449 ~ 3717941 (-)
G272624 NA non-coding downstream 3857 3598798 ~ 3599122 (-)
G272618 NA non-coding downstream 10541 3592149 ~ 3592438 (-)
G272615 NA non-coding downstream 13611 3588995 ~ 3589368 (-)
G272614 NA non-coding downstream 14450 3588328 ~ 3588529 (-)
G272613 NA non-coding downstream 15178 3587556 ~ 3587801 (-)
G272622 NA non-coding upstream 12633 3615867 ~ 3617620 (-)
G272630 NA non-coding upstream 16134 3619368 ~ 3619594 (-)
G272604 NA non-coding upstream 59320 3662554 ~ 3666238 (-)
G272637 NA non-coding upstream 72429 3675663 ~ 3678834 (-)
G272640 NA non-coding upstream 89545 3692779 ~ 3701605 (-)
G272221 NA other downstream 1617751 1959102 ~ 1985228 (-)
CI01000066_01843043_01848783 NA other downstream 1754120 1842554 ~ 1849466 (-)
CI01000066_01823227_01826380 NA other downstream 1778276 1823029 ~ 1826817 (-)

Expression



Co-expression Network