CI01000068_00969924_00981247 (TIMP3)


Basic Information

Item Value
gene id CI01000068_00969924_00981247
gene name TIMP3
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000068
NCBI id null
chromosome length 1053214
location 969903 ~ 981314 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000068_00969924_00981247.mRNA
AGTGTGCACGCGAAGCGCGTTCTAGTCTAACAGCACGGGAGCTTTAACAGCCGCATAACACTTCAAAATGAAGCCTTGTTTGGTGCTCGTGTTCCTTCTGTTCTCTCTCGTCTGTCTGATGTACCAGGCGTCGGACGCGTGTTCATGCGCGATGTCTCATCCACAGGAGGCGTACTGCAACTCCGACATTGTGATCAGGGCAAAAGTGGTGGGCAAGAAACTCCTGGACGACCGTCCGTTCGGAACCATGCGCTACACGGTCAAACAGATGAAGATGTACAAGGGCTTCGACAAGATCCAGCATGTGCAGTACATCTACACACACAACTCCGAGAGCATGTGCGGAGTCAAGTTCGACATCAACAAATACCAGTACCTGATCACAGGTCGTGTTCATGACGGGAAGGTTTACACCGGCCTGTGTAACTTCAACGAGCGCTGGGAACGCTTGTCTCTGGCTCAGAAGAAGGGCATCAACCACCGCTATCAGCTGGGCTGCAACTGCAGGATTAAGCCGTGTCACTACCTGCCCTGCTTCGTGACCTCCAAACACGAGTGCCTGTGGACGGACATGCTGTCCCACTTCGGCTACCCCGGGTATCAGTCCCGCAACTACGCCTGCATCCAGCAGAAGGAGGGCTACTGCAGCTGGTACCGAGGGATGACCACCCGCGACAAAGTGACCATCAACACCACCGACCCCTGAACCCGCCCTAACAACAATAAC

Function

symbol description
timp3 Predicted to enable metalloendopeptidase inhibitor activity and protease binding activity. Involved in negative regulation of ERK1 and ERK2 cascade; negative regulation of membrane protein ectodomain proteolysis; and positive regulation of TRAIL-activated apoptotic signaling pathway. Located in nucleus. Colocalizes with collagen-containing extracellular matrix. Implicated in Sorsby's fundus dystrophy; breast carcinoma; and urinary bladder cancer. Biomarker of several diseases, including breast cancer (multiple); preretinal fibrosis; reproductive organ cancer (multiple); thoracic aortic aneurysm; and type 2 diabetes mellitus.

GO: NA

KEGG:

id description
K16866 TIMP3; metalloproteinase inhibitor 3

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000068_00969924_00981247.mRNA True 727 mRNA 0.54 5 969903 981314

Neighbor

gene id symbol gene type direction distance location
CI01000068_00954838_00955167 NA coding downstream 14120 954416 ~ 955783 (-)
CI01000068_00919068_00936117 ETV6 coding downstream 33308 918741 ~ 936595 (-)
CI01000068_00902023_00912480 NA coding downstream 56410 901544 ~ 913493 (-)
CI01000068_00847176_00865067 LRIG3 coding downstream 103122 846674 ~ 866781 (-)
CI01000068_00835450_00835656 NA coding downstream 134247 835319 ~ 835656 (-)
CI01000068_00994252_00995274 NA coding upstream 12672 993986 ~ 995602 (-)
CI01000068_01000564_01002162 RERG coding upstream 18974 1000288 ~ 1002162 (-)
G273042 NA non-coding downstream 16956 950562 ~ 952947 (-)
G273192 NA non-coding downstream 182241 787461 ~ 787662 (-)
G273171 NA non-coding downstream 275503 693777 ~ 694400 (-)
CI01000068_00679462_00683567 NA non-coding downstream 289698 679021 ~ 683567 (-)
CI01000068_00644494_00651464 NA non-coding downstream 324782 643982 ~ 651464 (-)
G273032 NA non-coding upstream 15538 996852 ~ 999620 (-)
CI01000068_00663458_00672380 DPYSL5B, DPYSL5 other downstream 305007 662204 ~ 672380 (-)
CI01000068_00582352_00600267 NA other downstream 369505 582054 ~ 601519 (-)

Expression


Co-expression Network