G273144



Basic Information


Item Value
gene id G273144
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000068
NCBI id null
chromosome length 1053214
location 452331 ~ 452563 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU309965
CTTATTAAATCGTGTTGCACAGGTAACATACTGTTGAAAATTTCGCAGGGTATGTTTCAAAGAGCAATGGTTAAAATCCCCCATGATAAAATTAGGGGCATCAGGGGAAACATTCTGCAACTTAGAAACAATATGTTCAACAGTCTCCTTCACTTTAGCCTCATTTGCTTTAGGGTGAATATACACCACCGTAACAAAGATTTGAGGGAATTCTCGAGGTAAGTAAAATGGCC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU309965 True 233 lncRNA 0.39 1 452331 452563

Neighbor


gene id symbol gene type direction distance location
CI01000068_00449335_00450163 NA coding downstream 2168 449335 ~ 450163 (-)
CI01000068_00442295_00444826 NA coding downstream 7505 441650 ~ 444826 (-)
CI01000068_00423240_00429403 PROSER2 coding downstream 21711 422701 ~ 430620 (-)
CI01000068_00236826_00238310 CHRM2, CHRM2A coding downstream 213166 236169 ~ 239165 (-)
CI01000068_00174820_00180047 NA coding downstream 272284 173549 ~ 180047 (-)
CI01000068_00466560_00470556 NA coding upstream 13244 465807 ~ 470556 (-)
CI01000068_00478512_00488030 XPOT coding upstream 24484 477047 ~ 488902 (-)
CI01000068_00496537_00503427 NA coding upstream 43716 496279 ~ 503427 (-)
CI01000068_00582352_00600267 NA coding upstream 129491 582054 ~ 601519 (-)
CI01000068_00603672_00617563 TULP4A, TULP4 coding upstream 150141 602704 ~ 617563 (-)
G273141 NA non-coding downstream 10744 441367 ~ 441587 (-)
G273129 NA non-coding downstream 95658 356471 ~ 356673 (-)
G273121 NA non-coding downstream 109310 342679 ~ 343021 (-)
G273115 NA non-coding downstream 129382 322634 ~ 322949 (-)
G273114 NA non-coding downstream 132115 319900 ~ 320216 (-)
G273145 NA non-coding upstream 400 452963 ~ 453297 (-)
G273146 NA non-coding upstream 1169 453732 ~ 454079 (-)
G273147 NA non-coding upstream 3506 456069 ~ 456305 (-)
CI01000068_00644494_00651464 NA non-coding upstream 191442 643982 ~ 651464 (-)
CI01000068_00663458_00672380 DPYSL5B, DPYSL5 other upstream 209641 662204 ~ 672380 (-)

Expression



Co-expression Network