Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_010483

Basic Information

Item	Value
gene id	XLOC_010483
gene name	NA
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007127.7
NCBI id	CM002900.2
chromosome length	55266484
location	11597384 ~ 11639472 (-)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00022126
GTTTTGCCGTCTCAGAGCTGACAGGGTTACTGTATGTACACTGATATTCTCCAGTGTCTGATCTCTGCACTGGACTGATGGACACTGATCTGTTATCAGATGAGAAGATGATTCTGCTGCTAGAAGACAGAGGACTGTTATCTTTCATCCACTGCACAGAGGTGACGTTGCCGTTTCCCTTTGAGGTGATGTTAGCAGATGATTCTCTCTC

Function

GO: NA

KEGG:

id	description
ko03230	Viral genome structure
ko05164	Influenza A
ko03200	Viral proteins

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00022126	True	211	lncRNA	0.46	2	11597384	11639472

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_010482	BX005242.1	coding	downstream	58563	11437869 ~ 11538821 (-)
XLOC_010481	znf526	coding	downstream	355960	11227246 ~ 11241424 (-)
XLOC_010480	NA	coding	downstream	585732	10980052 ~ 11011652 (-)
XLOC_010479	NA	coding	downstream	677950	10917584 ~ 10919434 (-)
XLOC_010478	CU468227.1	coding	downstream	680980	10916290 ~ 10916404 (-)
XLOC_010484	zgc:158701	coding	upstream	121130	11760602 ~ 11779661 (-)
XLOC_010485	tlr21	coding	upstream	146495	11785967 ~ 11789108 (-)
XLOC_010486	cnfn	coding	upstream	151168	11790640 ~ 11798994 (-)
XLOC_010487	cxcr3.1	coding	upstream	213740	11853212 ~ 11859309 (-)
XLOC_010488	cd4-1	coding	upstream	272425	11911897 ~ 11946139 (-)
XLOC_010626	CR392024.2	misc	upstream	9255640	20895112 ~ 20895175 (-)
XLOC_010477	NA	non-coding	downstream	737770	10849706 ~ 10859614 (-)
XLOC_010491	NA	non-coding	upstream	353094	11992566 ~ 12005084 (-)
XLOC_010492	CU467865.1	non-coding	upstream	372602	12012074 ~ 12012188 (-)
XLOC_010497	CR388102.3	non-coding	upstream	599935	12239407 ~ 12239460 (-)
XLOC_010498	CR388102.2	non-coding	upstream	608390	12247862 ~ 12247920 (-)
XLOC_010499	CR388102.4	non-coding	upstream	610796	12250268 ~ 12250323 (-)

Expression

Co-expression Network