CI01000069_03804630_03807180 (PRMT1.S, PRMT1)


Basic Information

Item Value
gene id CI01000069_03804630_03807180
gene name PRMT1.S, PRMT1
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 3804616 ~ 3807180 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000069_03804630_03807180.mRNA
ATGACGGAAAGCTGCAAGAAAGAGGGCGGGGATCACGTGACCGTCGCCCAATCAAATCATTTAGCTGCAGCTAAGAGGCGGGAGCAAAACAAGTGTGTTTTACATGAGCTTTGCTGCAGTCATCGTGGAATCCAGTTTATCGAAATGGCGGAGACGGCAGACGGAATGGAGGAGATGCTAAAGGATGAAGTTCGTACTCTGACGTACAGAAACTCCATGTTCCACAACAAGCATCTCTTCAAGGATAAAGTGGTGCTGGATGTGGGAAGTGGAACCGGCATCCTCTGTATGTTTGCAGCCAAAGCTGGGGCCAAAAAAGTTATTGGGATTGAGTGCAGCAGTATATCAGACTATGCTGTGAAGATTGTGAAGGCCAACAAGTTGGATCATATCGTAACCATTATTAAGGGCAAAGTGGAGGAGGTTGAGCTTCCCGTGGAAAAAGTAGACATAATCATCTCTGAATGGATGGGCTACTGTCTCTTCTACGAATCCATGCTCAACACTGTCATTTATGCAAGAGACAAATGGCTGAAACCTGATGGTCTGATTTTCCCTGACAGAGCCACGCTCTATGTCACTGCTATTGAGGACCGACAGTACAAGGACTACAAAATTCACT

Function

symbol description
prmt1 Enables arginine N-methyltransferase activity. Acts upstream of or within convergent extension involved in gastrulation and histone H4-R3 methylation. Predicted to be active in nucleus. Is expressed in several structures, including adaxial cell; brain; heart; otic vesicle; and pleuroperitoneal region. Orthologous to human PRMT1 (protein arginine methyltransferase 1).

GO:

id name namespace
GO:0006479 protein methylation biological_process

KEGG:

id description
K11434 PRMT1; type I protein arginine methyltransferase

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000069_03804630_03807180.mRNA False 622 mRNA 0.46 5 3804630 3807180

Neighbor

gene id symbol gene type direction distance location
CI01000069_03768812_03787588 BRSK1 coding downstream 17042 3765673 ~ 3787588 (-)
CI01000069_03739653_03764284 CPT1CB coding downstream 40346 3738450 ~ 3764284 (-)
CI01000069_03721128_03722393 NA coding downstream 82237 3720944 ~ 3722393 (-)
CI01000069_03678617_03697993 PIH1D1 coding downstream 105874 3678298 ~ 3698756 (-)
CI01000069_03670799_03677837 NA coding downstream 126787 3670271 ~ 3677843 (-)
CI01000069_03871972_03884153 NA coding upstream 64745 3871925 ~ 3884153 (-)
CI01000069_03939251_03942780 RCN3 coding upstream 132024 3939204 ~ 3943095 (-)
CI01000069_03972492_03982847 TSPAN4B coding upstream 164910 3972090 ~ 3982957 (-)
CI01000069_03986480_03988243 NA coding upstream 177997 3985177 ~ 3988612 (-)
CI01000069_04129986_04133876 MYLPFB, MYLPF, MLC-2, MYLPFA coding upstream 322545 4129725 ~ 4133923 (-)
G275756 NA non-coding downstream 7678 3791589 ~ 3796952 (-)
G275921 NA non-coding downstream 66941 3737472 ~ 3737689 (-)
G275920 NA non-coding downstream 67672 3736654 ~ 3736958 (-)
G275754 NA non-coding downstream 168367 3612753 ~ 3636263 (-)
G275828 NA non-coding downstream 171516 3614318 ~ 3633114 (-)
G275790 NA non-coding upstream 16212 3823392 ~ 3826580 (-)
G275773 NA non-coding upstream 32054 3839234 ~ 3843586 (-)
G275827 NA non-coding upstream 41401 3848581 ~ 3848979 (-)
G275946 NA non-coding upstream 93725 3900905 ~ 3901166 (-)
G275953 NA non-coding upstream 152390 3959570 ~ 3959891 (-)
CI01000069_03415853_03417644 LIMD2 other downstream 378256 3412973 ~ 3417644 (-)
G275699 NA other downstream 726462 2992504 ~ 3078168 (-)
CI01000069_02997434_03008924 NA other downstream 804197 2997275 ~ 3008924 (-)
CI01000069_04932463_04940554 NA other upstream 1132341 4932144 ~ 4941471 (-)

Expression


Co-expression Network