Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

G273493

Basic Information

Item	Value
gene id	G273493
gene name	NA
gene type	non-coding
species	grasscarp (Ctenopharyngodon idella)
category of species	economic fish

Chromosome Information

Item	Value
chromosome id	CI01000069
NCBI id	null
chromosome length	5329268
location	48300 ~ 48503 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU310340
TGCTATATCATGTCCATATGTTGTAATATTAAGAAACAGCATAGTGTATTGAGTAACTTGTATTTTCGGTGAGAAACTGTGTCTGGTTGCATAAACTGCTTGGACTAGTCTTACAAGCTAGTCATCTTTTGTCTTTAAGATTGATCAACTTTTTACATGAAAAAATACATTGAATCTAATTTGAAAATACATACATCTAATTTG

Function

NR:

description
uncharacterized protein LOC105941010, partial

GO:

id	name	namespace
GO:0016071	mRNA metabolic process	biological_process
GO:0000375	RNA splicing, via transesterification reactions	biological_process
GO:0000377	RNA splicing, via transesterification reactions with bulged adenosine as nucleophile	biological_process
GO:0006397	mRNA processing	biological_process
GO:0000398	mRNA splicing, via spliceosome	biological_process
GO:0016607	nuclear speck	cellular_component
GO:0005681	spliceosomal complex	cellular_component
GO:0005685	U1 snRNP	cellular_component

KEGG:

id	description
ko03040	Spliceosome

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU310340	True	204	lncRNA	0.30	1	48300	48503

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
CI01000069_00041648_00043198	EHD3	coding	downstream	4859	41648 ~ 43441 (-)
CI01000069_00029366_00037113	NA	coding	downstream	10734	29357 ~ 37566 (-)
CI01000069_00000091_00001650	HSPA6, HSP70B, HSPA1B, HSP70A, ADA, HSP70.1, HSP70.3, HSP70.2, HSP70L	coding	downstream	46027	91 ~ 2273 (-)
CI01000069_00059923_00065619	MAPK3, MAPK1, MK03	coding	upstream	11350	59853 ~ 66016 (-)
CI01000069_00070778_00073734	BRAFLDRAFT_264576, BRAFLDRAFT_218264, BRAFLDRAFT_218328, PPP4CB, PPP4C, PPP4CA	coding	upstream	21993	70496 ~ 74403 (-)
CI01000069_00142555_00146746	NA	coding	upstream	93820	142323 ~ 147185 (-)
CI01000069_00156359_00158953	NA	coding	upstream	107229	155658 ~ 160090 (-)
CI01000069_00197131_00227540	XYLT1	coding	upstream	148586	197089 ~ 227924 (-)
CI01000069_00044853_00051264	YPEL1, YPEL3, YPEL2, YPELD, YPELA, YPELC	non-coding	downstream	8656	43906 ~ 52896 (-)
G273488	NA	non-coding	upstream	17795	66298 ~ 66999 (-)
G273482	NA	non-coding	upstream	51217	99720 ~ 120649 (-)
G273483	NA	non-coding	upstream	103033	151536 ~ 154085 (-)
G273528	NA	non-coding	upstream	219652	268155 ~ 268357 (-)
CI01000069_00952894_00955774	NA	other	upstream	764732	952361 ~ 955790 (-)
G275178	NA	other	upstream	878420	926923 ~ 945804 (-)
CI01000069_01645966_01647142	NA	other	upstream	1597265	1644522 ~ 1647326 (-)
CI01000069_02589498_02621318	SYT3	other	upstream	2562672	2589469 ~ 2621641 (-)
CI01000069_02997434_03008924	NA	other	upstream	2940523	2997275 ~ 3008924 (-)

Expression

Co-expression Network