G273712


Basic Information

Item Value
gene id G273712
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 757368 ~ 757573 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU310578
CGTAACTAAGTCAGCTAACTTAATAAGCCGCCTTTCCACTGCACAGGACAGCCGTTGGACCGGAAGTCATTCATTTCCAATGGAGAGTAGTACGGGGGCTGCGTGGAGTTCCGATCATATGCCAATGCGGAAATTTCGGATCCGATTTGAGCTTCGGATGCATTGAAATATTTGAACTTCTGCGGCTAGACCGTATGCGACCGGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU310578 True 206 lncRNA 0.50 1 757368 757573

Neighbor

gene id symbol gene type direction distance location
CI01000069_00583939_00586883 NA coding downstream 170485 583794 ~ 586883 (-)
CI01000069_00564614_00567490 NA coding downstream 189792 563530 ~ 567576 (-)
CI01000069_00516206_00538847 NA coding downstream 217774 516206 ~ 539594 (-)
CI01000069_00486030_00493370 NA coding downstream 263998 485818 ~ 493370 (-)
CI01000069_00411079_00477452 CLEC16A coding downstream 279916 410292 ~ 477452 (-)
CI01000069_00919963_00924163 CUNH16ORF72, C16ORF72, C2H16ORF72, C16ORF72.S, C6H16ORF72, CLG13H16ORF72 coding upstream 162348 919921 ~ 925610 (-)
CI01000069_00952894_00955774 NA coding upstream 194811 952361 ~ 955790 (-)
CI01000069_00983726_00984227 PDE6G coding upstream 225580 983153 ~ 984314 (-)
CI01000069_01023405_01025613 NA coding upstream 265769 1023342 ~ 1026058 (-)
CI01000069_01052717_01076129 ABAT coding upstream 294635 1052208 ~ 1076129 (-)
G273558 NA non-coding downstream 177648 519190 ~ 579720 (-)
G273612 NA non-coding downstream 188275 565044 ~ 569093 (-)
G273562 NA non-coding downstream 274659 482295 ~ 482709 (-)
G273564 NA non-coding downstream 275859 481062 ~ 481509 (-)
G273599 NA non-coding downstream 357696 399466 ~ 399672 (-)
G273726 NA non-coding upstream 16058 773631 ~ 773953 (-)
G273727 NA non-coding upstream 16617 774190 ~ 774466 (-)
G273728 NA non-coding upstream 17758 775331 ~ 775658 (-)
G275173 NA non-coding upstream 158911 916484 ~ 952244 (-)
G275234 NA non-coding upstream 207811 965384 ~ 966878 (-)
CI01000069_00044853_00051264 YPEL1, YPEL3, YPEL2, YPELD, YPELA, YPELC other downstream 710154 43906 ~ 52896 (-)
G275178 NA other upstream 169350 926923 ~ 945804 (-)
CI01000069_01645966_01647142 NA other upstream 888195 1644522 ~ 1647326 (-)
CI01000069_02589498_02621318 SYT3 other upstream 1853602 2589469 ~ 2621641 (-)
CI01000069_02997434_03008924 NA other upstream 2231453 2997275 ~ 3008924 (-)

Expression


Co-expression Network