G275284


Basic Information

Item Value
gene id G275284
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 1450410 ~ 1450722 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU312334
GTTCGGACCACCTCTACTAAGGCACATCTGGAAGCTGAATTCCGAGCTGCCATTTTCAGCATTGCAGCGATGCGAATAAGGCACTGCATTCACACCCCCCTGGGGGTCTGGAAAAACTTTCACACAGCTACAGATACTATTTAATACACCTTTTTAGCATGAGTTGAATTTAGCTCTTCCATCATCCTGACTCAGTATAACCACATGTGCTATTCAACACCCTTGTGTTTTCATTACCATTTCAGATTTGGTATCTAATGTTCCAAATGGAAATACATAGTTTAAAAAAAGTGAAAAAAGGAACTCATGGCTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU312334 True 313 lncRNA 0.41 1 1450410 1450722

Neighbor

gene id symbol gene type direction distance location
CI01000069_01410825_01412802 NA coding downstream 37255 1410587 ~ 1413155 (-)
CI01000069_01155772_01178120 RBFOX1 coding downstream 272290 1155442 ~ 1178120 (-)
CI01000069_01141607_01144384 NA coding downstream 305589 1141470 ~ 1144821 (-)
CI01000069_01085974_01097576 METTL22 coding downstream 352834 1085650 ~ 1097576 (-)
CI01000069_01052717_01076129 ABAT coding downstream 374281 1052208 ~ 1076129 (-)
CI01000069_01519314_01531186 FBXL16 coding upstream 68479 1519201 ~ 1531586 (-)
CI01000069_01571371_01593400 GSG1L coding upstream 120649 1571371 ~ 1593400 (-)
CI01000069_01632361_01633951 NA coding upstream 181502 1632224 ~ 1633951 (-)
CI01000069_01645966_01647142 NA coding upstream 193800 1644522 ~ 1647326 (-)
CI01000069_01653730_01654507 EEF2KMT coding upstream 202984 1653706 ~ 1654507 (-)
G275276 NA non-coding downstream 29562 1420411 ~ 1420848 (-)
G275195 NA non-coding downstream 55227 1391823 ~ 1395183 (-)
G275188 NA non-coding downstream 69256 1371056 ~ 1381154 (-)
G275189 NA non-coding downstream 101186 1343436 ~ 1349224 (-)
G275182 NA non-coding downstream 143529 1273440 ~ 1306881 (-)
G275286 NA non-coding upstream 2404 1453126 ~ 1453361 (-)
G275187 NA non-coding upstream 3731 1454453 ~ 1455732 (-)
G275288 NA non-coding upstream 9062 1459784 ~ 1460061 (-)
G275289 NA non-coding upstream 12074 1462796 ~ 1463027 (-)
G275290 NA non-coding upstream 17197 1467919 ~ 1468137 (-)
CI01000069_00952894_00955774 NA other downstream 494620 952361 ~ 955790 (-)
G275178 NA other downstream 504606 926923 ~ 945804 (-)
CI01000069_00044853_00051264 YPEL1, YPEL3, YPEL2, YPELD, YPELA, YPELC other downstream 1403196 43906 ~ 52896 (-)
CI01000069_02589498_02621318 SYT3 other upstream 1160453 2589469 ~ 2621641 (-)
CI01000069_02997434_03008924 NA other upstream 1538304 2997275 ~ 3008924 (-)
G275699 NA other upstream 1541782 2992504 ~ 3078168 (-)
CI01000069_03415853_03417644 LIMD2 other upstream 1962251 3412973 ~ 3417644 (-)

Expression


Co-expression Network