G275297


Basic Information

Item Value
gene id G275297
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 1484673 ~ 1484887 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU312347
CTCAGAGCCACATGCAGGGTCTGTATGCTCCGCTGCGTCTACAGCTAATTAACTGACTGAGGTTTGTTAATGGAGTTTCCTACAAAGTGCTCTCCACCGCCACATCGTTCTGGTCATTCCAGGTCATTATCTGATGACTAATGCATCTTTTCCTCTTCGAATCCACACACTCTGGACATCTCTGCATGATAAGCTACACTTACAATAAATCTGAG

Function

NR:

description
PREDICTED: DNA-binding protein SATB2-like isoform X7

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU312347 True 215 lncRNA 0.45 1 1484673 1484887

Neighbor

gene id symbol gene type direction distance location
CI01000069_01410825_01412802 NA coding downstream 71518 1410587 ~ 1413155 (-)
CI01000069_01155772_01178120 RBFOX1 coding downstream 306553 1155442 ~ 1178120 (-)
CI01000069_01141607_01144384 NA coding downstream 339852 1141470 ~ 1144821 (-)
CI01000069_01085974_01097576 METTL22 coding downstream 387097 1085650 ~ 1097576 (-)
CI01000069_01052717_01076129 ABAT coding downstream 408544 1052208 ~ 1076129 (-)
CI01000069_01519314_01531186 FBXL16 coding upstream 34314 1519201 ~ 1531586 (-)
CI01000069_01571371_01593400 GSG1L coding upstream 86484 1571371 ~ 1593400 (-)
CI01000069_01632361_01633951 NA coding upstream 147337 1632224 ~ 1633951 (-)
CI01000069_01645966_01647142 NA coding upstream 159635 1644522 ~ 1647326 (-)
CI01000069_01653730_01654507 EEF2KMT coding upstream 168819 1653706 ~ 1654507 (-)
G275295 NA non-coding downstream 2963 1480616 ~ 1481710 (-)
G275294 NA non-coding downstream 9451 1474999 ~ 1475222 (-)
G275293 NA non-coding downstream 12136 1472105 ~ 1472537 (-)
G275292 NA non-coding downstream 12732 1471740 ~ 1471941 (-)
G275291 NA non-coding downstream 14376 1470035 ~ 1470297 (-)
G275323 NA non-coding upstream 72869 1557756 ~ 1557983 (-)
G275332 NA non-coding upstream 113122 1598009 ~ 1839199 (-)
G275342 NA non-coding upstream 133207 1618094 ~ 1622870 (-)
G275326 NA non-coding upstream 168843 1654902 ~ 1745745 (-)
CI01000069_00952894_00955774 NA other downstream 528883 952361 ~ 955790 (-)
G275178 NA other downstream 538869 926923 ~ 945804 (-)
CI01000069_00044853_00051264 YPEL1, YPEL3, YPEL2, YPELD, YPELA, YPELC other downstream 1437459 43906 ~ 52896 (-)
CI01000069_02589498_02621318 SYT3 other upstream 1126288 2589469 ~ 2621641 (-)
CI01000069_02997434_03008924 NA other upstream 1504139 2997275 ~ 3008924 (-)
G275699 NA other upstream 1507617 2992504 ~ 3078168 (-)
CI01000069_03415853_03417644 LIMD2 other upstream 1928086 3412973 ~ 3417644 (-)

Expression


Co-expression Network