G274225


Basic Information

Item Value
gene id G274225
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 2486969 ~ 2487307 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU311130
ATAATTATATATAATTAAGTTTTTTTTATGTGTTAAGCATAAAAATATATTTATTTATTTATTTATTTATTATTATTATTTATTTAGCAAATGTGATAAGGAAAAAATGTATTGTTCTCTGAGAAGTTAAGCCTTATTTTGTGTAATGTCTTGTTATAAAGGGTTAGTTCACCCAAAAATGAAAATTCTGTCATTTATTACTCACCCTCATGTCGTTCCACACCTGTAAGACCTTCGTTCATCTTCTGAACACAAATTAACATATTTTTGATGAAATCCGATGGCTCAGTGAGGCCTCTATTGACAGCAAGATAATAAACACTTTCAGATGCCCATAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU311130 True 339 lncRNA 0.28 1 2486969 2487307

Neighbor

gene id symbol gene type direction distance location
CI01000069_02466489_02467309 NA coding upstream 19572 2465780 ~ 2467397 (+)
CI01000069_02454588_02465668 MYBPC2, MYBPC2A coding upstream 21288 2454588 ~ 2465681 (+)
CI01000069_02393010_02396796 AKT1S1 coding upstream 89237 2393010 ~ 2397732 (+)
CI01000069_02311794_02313206 NA coding upstream 171959 2311794 ~ 2315010 (+)
CI01000069_02256234_02263001 NA coding upstream 223848 2256169 ~ 2263121 (+)
CI01000069_02540591_02547912 NA coding downstream 53203 2540510 ~ 2548022 (+)
CI01000069_02818349_02821933 CLDNI coding downstream 330933 2818240 ~ 2821937 (+)
CI01000069_02857196_02860525 NA coding downstream 369115 2856422 ~ 2860562 (+)
CI01000069_02862381_02864927 PRF1.1 coding downstream 374347 2861654 ~ 2864993 (+)
CI01000069_02894136_02894807 COX6A2 coding downstream 406111 2893418 ~ 2894947 (+)
G274215 NA non-coding upstream 17593 2469154 ~ 2469376 (+)
G274207 NA non-coding upstream 63775 2412265 ~ 2423194 (+)
G274206 NA non-coding upstream 74773 2411832 ~ 2412196 (+)
G274197 NA non-coding upstream 112651 2373985 ~ 2374318 (+)
G274156 NA non-coding upstream 122368 2363135 ~ 2364601 (+)
G274226 NA non-coding downstream 1825 2489132 ~ 2489630 (+)
G274227 NA non-coding downstream 4839 2492146 ~ 2498586 (+)
G274250 NA non-coding downstream 51136 2538443 ~ 2538669 (+)
G274253 NA non-coding downstream 56657 2543964 ~ 2544190 (+)
G274238 NA non-coding downstream 61740 2549047 ~ 2552438 (+)
CI01000069_02033431_02040119 EIF3D.S, EIF3D other upstream 314776 2031954 ~ 2040427 (+)
G273359 NA other upstream 2007888 477727 ~ 479081 (+)
G274270 NA other downstream 185317 2672624 ~ 2681158 (+)
G274603 NA other downstream 1312716 3800023 ~ 3803501 (+)
G274619 NA other downstream 1641821 4129128 ~ 4133378 (+)

Expression


Co-expression Network