G274715


Basic Information

Item Value
gene id G274715
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 3737265 ~ 3737533 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU311678
CGACTGACGTCACTGCCATTACACGATAGGCTGAGAGATTAAGTTAGCCGTTACGCTTTCTCCAACGGTAAGAGATACAGACCCTCTCATCTCCCTATAATATACAATCTCTGGTTATAATTTCTCTAATTTCCAGGTCAAGGTGCTGTGCATTGTGGTAATTGATGCGACATGACGTCACTTCCAAAGGACCAATGAACATATCTGACCAATTTCATGGAATGTGAAAACTAATCTCATTGGCTGAATAAATAACATTTAAATTAAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU311678 True 269 lncRNA 0.39 1 3737265 3737533

Neighbor

gene id symbol gene type direction distance location
CI01000069_03643296_03647762 SYT13, SYT5B, SYT5A coding upstream 89479 3643155 ~ 3647786 (+)
CI01000069_03636156_03639756 NA coding upstream 97280 3635980 ~ 3639985 (+)
CI01000069_03631837_03632897 NA coding upstream 104302 3631837 ~ 3632963 (+)
CI01000069_03625937_03626925 NA coding upstream 110104 3625937 ~ 3627161 (+)
CI01000069_03612923_03614657 NA coding upstream 122526 3612717 ~ 3614739 (+)
CI01000069_03766564_03767936 NA coding downstream 29031 3766564 ~ 3768198 (+)
CI01000069_03812664_03832205 AP2A1 coding downstream 75131 3812664 ~ 3832279 (+)
CI01000069_03835903_03837843 NA coding downstream 98370 3835903 ~ 3838319 (+)
CI01000069_03839830_03843013 RRAS coding downstream 102297 3839830 ~ 3843569 (+)
CI01000069_03845642_03851052 PRRG2 coding downstream 108109 3845642 ~ 3851213 (+)
G274651 NA non-coding upstream 5682 3728882 ~ 3731583 (+)
G274601 NA non-coding upstream 78830 3658230 ~ 3658435 (+)
G274564 NA non-coding upstream 281055 3452564 ~ 3456210 (+)
G274592 NA non-coding upstream 314761 3420898 ~ 3422504 (+)
G274589 NA non-coding upstream 324495 3412500 ~ 3412770 (+)
G274716 NA non-coding downstream 23368 3760901 ~ 3761638 (+)
G274721 NA non-coding downstream 35561 3773094 ~ 3773544 (+)
G274628 NA non-coding downstream 53973 3791506 ~ 3796972 (+)
G274731 NA non-coding downstream 60035 3797568 ~ 3797875 (+)
G274733 NA non-coding downstream 67083 3804616 ~ 3807059 (+)
CI01000069_02894136_02894807 COX6A2 other upstream 842377 2893418 ~ 2894947 (+)
G274270 NA other upstream 1056107 2672624 ~ 2681158 (+)
CI01000069_02033431_02040119 EIF3D.S, EIF3D other upstream 1565072 2031954 ~ 2040427 (+)
G273359 NA other upstream 3258184 477727 ~ 479081 (+)
G274603 NA other downstream 62490 3800023 ~ 3803501 (+)
G274619 NA other downstream 391595 4129128 ~ 4133378 (+)
CI01000069_04556116_04558002 PYY, PYYA other downstream 817776 4555269 ~ 4558480 (+)
G274953 NA other downstream 1186934 4924467 ~ 4926687 (+)
CI01000069_05046565_05048523 NA other downstream 1308694 5045967 ~ 5049408 (+)

Expression


Co-expression Network