G274603


Basic Information

Item Value
gene id G274603
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 3800023 ~ 3803501 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU311564
GGGTCTGTCATGTGTAGACTTTCTTTAAATGGCACGTGGCTGCAAGACTGTGTGAACTGTTTCAGGATTGAACTAGTTTCAATACACCTGGAGTGTAAGACTTACTGCATATCCAAATGAAAGAAGTAGGGCTATATAATGAAAAGCTCAAGAGAGGAAAGCAGAAAGCAAAGATTCAAGCAAGACGAGAATAAAGAAACCAGTTAAAATGATGGCTGAAGGATCTAGACTATACTTTGCAGTGACCGTCCTGATGTGTGCGTTTGTCTCAATCAACGGTGTCGGTCTGAATGATTTACTGGAAAGAGCCTCTCAACTTTCAGACAAACTTCACTCCCTCAGCACCTCTCTCACCAATGACCTGGATTCTCACTTTCCTCCTGTTGGGAGGGTAATGATGCCCCGTCCGTCGATGTGCCACACATCCTCCCTTCAAATTCCCAATGACAAAGACCAAGCCCTGAAAGTGCCGGTAAGAACACACTTTACTGCATCCATCTTCCTCTTTTTAAAATGTAAAAATACTTTCTCCTATTCCAGCTAAAATAAATATATATATTTTTTTAAATTAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU311564 True 572 TUCP 0.41 4 3800023 3803501

Neighbor

gene id symbol gene type direction distance location
CI01000069_03766564_03767936 NA coding upstream 31825 3766564 ~ 3768198 (+)
CI01000069_03643296_03647762 SYT13, SYT5B, SYT5A coding upstream 152237 3643155 ~ 3647786 (+)
CI01000069_03636156_03639756 NA coding upstream 160038 3635980 ~ 3639985 (+)
CI01000069_03631837_03632897 NA coding upstream 167060 3631837 ~ 3632963 (+)
CI01000069_03625937_03626925 NA coding upstream 172862 3625937 ~ 3627161 (+)
CI01000069_03812664_03832205 AP2A1 coding downstream 9163 3812664 ~ 3832279 (+)
CI01000069_03835903_03837843 NA coding downstream 32402 3835903 ~ 3838319 (+)
CI01000069_03839830_03843013 RRAS coding downstream 36329 3839830 ~ 3843569 (+)
CI01000069_03845642_03851052 PRRG2 coding downstream 42141 3845642 ~ 3851213 (+)
CI01000069_03854857_03870627 PRR12, PRR12B coding downstream 51356 3854857 ~ 3870933 (+)
G274731 NA non-coding upstream 2148 3797568 ~ 3797875 (+)
G274628 NA non-coding upstream 3051 3791506 ~ 3796972 (+)
G274721 NA non-coding upstream 26479 3773094 ~ 3773544 (+)
G274716 NA non-coding upstream 38385 3760901 ~ 3761638 (+)
G274715 NA non-coding upstream 62490 3737265 ~ 3737533 (+)
G274733 NA non-coding downstream 1115 3804616 ~ 3807059 (+)
G274737 NA non-coding downstream 70275 3873776 ~ 3873980 (+)
G274743 NA non-coding downstream 80036 3883537 ~ 3883757 (+)
G274746 NA non-coding downstream 118787 3922288 ~ 3922571 (+)
G274748 NA non-coding downstream 128567 3932068 ~ 3932404 (+)
CI01000069_02894136_02894807 COX6A2 other upstream 905135 2893418 ~ 2894947 (+)
G274270 NA other upstream 1118865 2672624 ~ 2681158 (+)
CI01000069_02033431_02040119 EIF3D.S, EIF3D other upstream 1627830 2031954 ~ 2040427 (+)
G273359 NA other upstream 3320942 477727 ~ 479081 (+)
G274619 NA other downstream 325627 4129128 ~ 4133378 (+)
CI01000069_04556116_04558002 PYY, PYYA other downstream 751808 4555269 ~ 4558480 (+)
G274953 NA other downstream 1120966 4924467 ~ 4926687 (+)
CI01000069_05046565_05048523 NA other downstream 1242726 5045967 ~ 5049408 (+)

Expression


Co-expression Network