G274737


Basic Information

Item Value
gene id G274737
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 3873776 ~ 3873980 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU311705
TGCATTTATGTACCATTTTCTTTACAGAGCACAAAAAGAAGCTCAGCTGCACATTGTTTGATATCAGTGTCGACGTGGGTCATTAGTCGCACTAGTCTGCTCCTCAGAGTGTTCCCCTGCTCAGGCCTCAGCTCAACGTCTCTCAGAGGAGGCAGGATCTGCTTAAACACAGCACAGGATTAGGCTACTGGTACATAGCCATAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU311705 True 205 lncRNA 0.47 1 3873776 3873980

Neighbor

gene id symbol gene type direction distance location
CI01000069_03854857_03870627 PRR12, PRR12B coding upstream 2843 3854857 ~ 3870933 (+)
CI01000069_03845642_03851052 PRRG2 coding upstream 22563 3845642 ~ 3851213 (+)
CI01000069_03839830_03843013 RRAS coding upstream 30207 3839830 ~ 3843569 (+)
CI01000069_03835903_03837843 NA coding upstream 35457 3835903 ~ 3838319 (+)
CI01000069_03812664_03832205 AP2A1 coding upstream 41497 3812664 ~ 3832279 (+)
CI01000069_03886826_03898833 SCAF1 coding downstream 12846 3886826 ~ 3899025 (+)
CI01000069_03902139_03920099 TRPM4A coding downstream 28159 3902139 ~ 3920299 (+)
CI01000069_03927870_03929948 NA coding downstream 53890 3927870 ~ 3930379 (+)
CI01000069_03935114_03939004 NOSIP coding downstream 60328 3934308 ~ 3939158 (+)
CI01000069_03953485_03961584 PAX10 coding downstream 79364 3953344 ~ 3961836 (+)
G274733 NA non-coding upstream 66717 3804616 ~ 3807059 (+)
G274731 NA non-coding upstream 75901 3797568 ~ 3797875 (+)
G274628 NA non-coding upstream 76804 3791506 ~ 3796972 (+)
G274721 NA non-coding upstream 100232 3773094 ~ 3773544 (+)
G274716 NA non-coding upstream 112138 3760901 ~ 3761638 (+)
G274743 NA non-coding downstream 9557 3883537 ~ 3883757 (+)
G274746 NA non-coding downstream 48308 3922288 ~ 3922571 (+)
G274748 NA non-coding downstream 58088 3932068 ~ 3932404 (+)
G274760 NA non-coding downstream 125003 3998983 ~ 4002223 (+)
G274671 NA non-coding downstream 265150 4139130 ~ 4140762 (+)
G274603 NA other upstream 70275 3800023 ~ 3803501 (+)
CI01000069_02894136_02894807 COX6A2 other upstream 978888 2893418 ~ 2894947 (+)
G274270 NA other upstream 1192618 2672624 ~ 2681158 (+)
CI01000069_02033431_02040119 EIF3D.S, EIF3D other upstream 1701583 2031954 ~ 2040427 (+)
G274619 NA other downstream 255148 4129128 ~ 4133378 (+)
CI01000069_04556116_04558002 PYY, PYYA other downstream 681329 4555269 ~ 4558480 (+)
G274953 NA other downstream 1050487 4924467 ~ 4926687 (+)
CI01000069_05046565_05048523 NA other downstream 1172247 5045967 ~ 5049408 (+)

Expression


Co-expression Network