G274746


Basic Information

Item Value
gene id G274746
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 3922288 ~ 3922571 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU311715
CACAAATTAAGATATTTTTAATGAGATCCGATGGCTCAGTGAGGCCTCCATTGAGAGCAAAACCGCTGAAACTCTCAAGGTCCATAAAGGTACTAAAAACATATTTAAAACAGTTCATGTGAGTTCAGTGGTTCTACCTTAATATTATAAAGCGACAAGAATACTTTTTTCAACAATATATAGTGATGGGTCGATTTCAAAACACTGCTTCAGAGCTTTACGAATCGAATCAGTGAATCGGAGCGCCAAAGTCACATGATTTCAACAGTTTTGATAGGAGATCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU311715 True 284 lncRNA 0.37 1 3922288 3922571

Neighbor

gene id symbol gene type direction distance location
CI01000069_03902139_03920099 TRPM4A coding upstream 1989 3902139 ~ 3920299 (+)
CI01000069_03886826_03898833 SCAF1 coding upstream 23263 3886826 ~ 3899025 (+)
CI01000069_03854857_03870627 PRR12, PRR12B coding upstream 51355 3854857 ~ 3870933 (+)
CI01000069_03845642_03851052 PRRG2 coding upstream 71075 3845642 ~ 3851213 (+)
CI01000069_03839830_03843013 RRAS coding upstream 78719 3839830 ~ 3843569 (+)
CI01000069_03927870_03929948 NA coding downstream 5299 3927870 ~ 3930379 (+)
CI01000069_03935114_03939004 NOSIP coding downstream 11737 3934308 ~ 3939158 (+)
CI01000069_03953485_03961584 PAX10 coding downstream 30773 3953344 ~ 3961836 (+)
CI01000069_03965213_03971865 NA coding downstream 42541 3965112 ~ 3972048 (+)
CI01000069_03991989_03994139 NA coding downstream 69107 3991678 ~ 3994317 (+)
G274743 NA non-coding upstream 38531 3883537 ~ 3883757 (+)
G274737 NA non-coding upstream 48308 3873776 ~ 3873980 (+)
G274733 NA non-coding upstream 115229 3804616 ~ 3807059 (+)
G274731 NA non-coding upstream 124413 3797568 ~ 3797875 (+)
G274628 NA non-coding upstream 125316 3791506 ~ 3796972 (+)
G274748 NA non-coding downstream 9497 3932068 ~ 3932404 (+)
G274760 NA non-coding downstream 76412 3998983 ~ 4002223 (+)
G274671 NA non-coding downstream 216559 4139130 ~ 4140762 (+)
G274659 NA non-coding downstream 218309 4140880 ~ 4141167 (+)
G274669 NA non-coding downstream 261631 4184202 ~ 4192064 (+)
G274603 NA other upstream 118787 3800023 ~ 3803501 (+)
CI01000069_02894136_02894807 COX6A2 other upstream 1027400 2893418 ~ 2894947 (+)
G274270 NA other upstream 1241130 2672624 ~ 2681158 (+)
CI01000069_02033431_02040119 EIF3D.S, EIF3D other upstream 1750095 2031954 ~ 2040427 (+)
G274619 NA other downstream 206557 4129128 ~ 4133378 (+)
CI01000069_04556116_04558002 PYY, PYYA other downstream 632738 4555269 ~ 4558480 (+)
G274953 NA other downstream 1001896 4924467 ~ 4926687 (+)
CI01000069_05046565_05048523 NA other downstream 1123656 5045967 ~ 5049408 (+)

Expression


Co-expression Network