G274779


Basic Information

Item Value
gene id G274779
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 4268215 ~ 4268822 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU311759
AGGTAATTGTTTAAAACCATGGCGAGTGTGAAAAGAAGTGGTCTCAGCATTTCGGTTCTTGAGCGATGTGTGTGATGTGTATCTCTGCCGCTCTTCACATGTCTAAATACGACCTTGTGAGTCAGTCAGACACTAGTTCCGCTTTTCGCTGTTACAACACTTCAGCCTCTGACACTGTCCTACACTAAATGTGCAGCACTTGTTTTCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU311759 True 208 lncRNA 0.44 3 4268215 4268822

Neighbor

gene id symbol gene type direction distance location
CI01000069_04230190_04235064 NA coding upstream 33134 4229369 ~ 4235081 (+)
CI01000069_04203202_04214241 NA coding upstream 53890 4203202 ~ 4214325 (+)
CI01000069_04165021_04170544 NA coding upstream 97660 4164128 ~ 4170555 (+)
CI01000069_04151875_04159107 NA coding upstream 109024 4151875 ~ 4159191 (+)
CI01000069_04143761_04147538 CD2BP2 coding upstream 120536 4143761 ~ 4147679 (+)
CI01000069_04412903_04419976 NA coding downstream 142413 4411235 ~ 4422342 (+)
CI01000069_04425809_04438936 NA coding downstream 155121 4423943 ~ 4439161 (+)
CI01000069_04527086_04527715 NA coding downstream 258179 4527001 ~ 4527814 (+)
CI01000069_04556116_04558002 PYY, PYYA coding downstream 286447 4555269 ~ 4558480 (+)
CI01000069_04562461_04568806 MPP2A coding downstream 293639 4562461 ~ 4568896 (+)
G274669 NA non-coding upstream 76151 4184202 ~ 4192064 (+)
G274659 NA non-coding upstream 127048 4140880 ~ 4141167 (+)
G274671 NA non-coding upstream 127453 4139130 ~ 4140762 (+)
G274760 NA non-coding upstream 265992 3998983 ~ 4002223 (+)
G274748 NA non-coding upstream 335811 3932068 ~ 3932404 (+)
G274781 NA non-coding downstream 1394 4270216 ~ 4272592 (+)
G274823 NA non-coding downstream 159268 4428090 ~ 4428396 (+)
G274824 NA non-coding downstream 159826 4428648 ~ 4429418 (+)
G274825 NA non-coding downstream 162192 4431014 ~ 4433247 (+)
G274619 NA other upstream 134837 4129128 ~ 4133378 (+)
G274603 NA other upstream 464714 3800023 ~ 3803501 (+)
CI01000069_02894136_02894807 COX6A2 other upstream 1373327 2893418 ~ 2894947 (+)
G274270 NA other upstream 1587057 2672624 ~ 2681158 (+)
G274953 NA other downstream 655645 4924467 ~ 4926687 (+)
CI01000069_05046565_05048523 NA other downstream 777405 5045967 ~ 5049408 (+)

Expression


Co-expression Network