G275008


Basic Information

Item Value
gene id G275008
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 4969222 ~ 4986267 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU312006
TATTTTACGATACAAATGTCCTTGCAATTAATGATAAAATCTTACTGTTTGTTACGGTGACTTTGGTGCCTCTTCCCCAGTAGTCGAAAGCCCAGTTACCTTCTCCTGCACAGAAATACACAGCTGAGTCCTCTTCTGTCAGTCTAGACAGTTTCAGATACACCATGCTTTTTGAATTGTCTCTAGTAATTTCTATTCGTCCCTCAAAACTTTTGGAATACTCATGTCCTTGTCCATTAGCCCAGACACGGCCCATCCAAATCAGTGCTTTCCCAGGTTGCTGTCTGACCCAGTGTATGTTGTAGCTTCCGAAAGTAAATCCTGATCCTCTACAGGAAAGACTCAGAGTTTCTCCAGGCTTTACCACTGATTGAGAAGAAATGGACTCCATATTCTGACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU312006 True 400 lncRNA 0.43 2 4969222 4986267

Neighbor

gene id symbol gene type direction distance location
CI01000069_04917103_04918567 ALKBH7 coding upstream 50321 4917103 ~ 4918901 (+)
CI01000069_04791495_04792375 NA coding upstream 176542 4791351 ~ 4792680 (+)
CI01000069_04776672_04785162 NA coding upstream 183790 4775370 ~ 4785432 (+)
CI01000069_04773976_04774606 NA coding upstream 194263 4773976 ~ 4774959 (+)
CI01000069_04612170_04623197 GTPBP1, GTPBP1L, GTPB1 coding upstream 345771 4612170 ~ 4623451 (+)
CI01000069_04990240_04994522 ALDH3B1 coding downstream 2468 4988735 ~ 4994869 (+)
CI01000069_05002707_05021316 CARM1.L, CARM1P1.L, CARM1 coding downstream 16440 5002707 ~ 5023082 (+)
CI01000069_05033299_05034403 NA coding downstream 47032 5033299 ~ 5034605 (+)
CI01000069_05046565_05048523 NA coding downstream 59700 5045967 ~ 5049408 (+)
CI01000069_05064327_05071992 SLC25A23B coding downstream 77849 5064116 ~ 5072032 (+)
G274958 NA non-coding upstream 4281 4963637 ~ 4964941 (+)
G274997 NA non-coding upstream 53137 4915853 ~ 4916085 (+)
G274993 NA non-coding upstream 61353 4907477 ~ 4907869 (+)
G274991 NA non-coding upstream 72211 4896210 ~ 4897011 (+)
G274979 NA non-coding upstream 107884 4861107 ~ 4861338 (+)
G275017 NA non-coding downstream 1498 4987765 ~ 4987990 (+)
G275047 NA non-coding downstream 52782 5039049 ~ 5039467 (+)
G275048 NA non-coding downstream 53355 5039622 ~ 5039915 (+)
CI01000069_05086587_05092363 NA non-coding downstream 99767 5086034 ~ 5092572 (+)
G274953 NA other upstream 42535 4924467 ~ 4926687 (+)
CI01000069_04556116_04558002 PYY, PYYA other upstream 410742 4555269 ~ 4558480 (+)
G274619 NA other upstream 835844 4129128 ~ 4133378 (+)
G274603 NA other upstream 1165721 3800023 ~ 3803501 (+)

Expression


Co-expression Network