G275087


Basic Information

Item Value
gene id G275087
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 5175118 ~ 5175383 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU312108
TCCATATTTAACACGTTATAAAGTAAAATAACTAGTTTCAAGCAAAATGGCCATAGGGATTCTACTTACATCTAAAGCGTAACTTACACAACGTATAACGTAGGAAGTAGCGTAGTATGTCATGGCGTAATGTAATACCAGTAGAAGGTAGCATAAGTTACGCTTTAGACGTATGTAAAATCCGTTTGGCCAGAAGCTAGTTATTTTACTTTATAACGTGTTAAATATGGATATTTTTCTTACACAAACACATCGCTTCACTTCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU312108 True 266 lncRNA 0.34 1 5175118 5175383

Neighbor

gene id symbol gene type direction distance location
CI01000069_05150719_05164593 NA coding upstream 9730 5148059 ~ 5165388 (+)
CI01000069_05097987_05099733 NA coding upstream 75277 5097987 ~ 5099841 (+)
CI01000069_05086587_05092363 NA coding upstream 82546 5086034 ~ 5092572 (+)
CI01000069_05077178_05084933 ZNF207B, ZNF207 coding upstream 89656 5077178 ~ 5085462 (+)
CI01000069_05064327_05071992 SLC25A23B coding upstream 103086 5064116 ~ 5072032 (+)
G275086 NA non-coding upstream 137 5174482 ~ 5174981 (+)
G275085 NA non-coding upstream 1808 5171866 ~ 5173310 (+)
G275065 NA non-coding upstream 57162 5117742 ~ 5117956 (+)
G275022 NA non-coding upstream 78137 5094112 ~ 5096981 (+)
G275035 NA non-coding downstream 9348 5184731 ~ 5185209 (+)
G275101 NA non-coding downstream 10670 5186053 ~ 5186900 (+)
G275108 NA non-coding downstream 17990 5193373 ~ 5193673 (+)
G275088 NA non-coding downstream 51299 5226682 ~ 5229746 (+)
G275159 NA non-coding downstream 99546 5274929 ~ 5275290 (+)
CI01000069_05046565_05048523 NA other upstream 126128 5045967 ~ 5049408 (+)
G274953 NA other upstream 248431 4924467 ~ 4926687 (+)
CI01000069_04556116_04558002 PYY, PYYA other upstream 616638 4555269 ~ 4558480 (+)
G274619 NA other upstream 1041740 4129128 ~ 4133378 (+)
G274603 NA other upstream 1371617 3800023 ~ 3803501 (+)

Expression


Co-expression Network