G280373


Basic Information

Item Value
gene id G280373
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000071
NCBI id null
chromosome length 5214881
location 560987 ~ 561222 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU317880
GAAGGCGATTGGTAAAATACTCAAAAATAATGAGCCACATTAATTGTTTATGTTGATTTGACAAAAGAAAAAATGTTGTGATAAATCATAAAAAGAATTTTTACAGTGCATGACTTAAAAAAACCTATAACATACAATTATGAGACGATCAATGAAAAATCATGCAGCTGTATCTCATTCACACACACCACAATGTGTGATTCTCCTGATCCGCAATATGTGACTCACACTCCCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU317880 True 236 lncRNA 0.33 1 560987 561222

Neighbor

gene id symbol gene type direction distance location
CI01000071_00544529_00545575 FOXD1 coding upstream 15146 544249 ~ 545841 (+)
CI01000071_00531716_00534432 ANKRA2 coding upstream 26025 530382 ~ 534962 (+)
CI01000071_00335696_00339048 NA coding upstream 221414 335049 ~ 339573 (+)
CI01000071_00329399_00333840 ENC1, CCIN coding upstream 226503 329399 ~ 334484 (+)
CI01000071_00305940_00316066 GFM2 coding upstream 244518 305114 ~ 316469 (+)
CI01000071_00707882_00708320 NA coding downstream 145666 706888 ~ 709581 (+)
CI01000071_00792254_00802384 SLC6A4B, SLC6A4 coding downstream 230124 791346 ~ 803317 (+)
CI01000071_00807216_00807677 NA coding downstream 245609 806831 ~ 808142 (+)
CI01000071_00825247_00853236 GIT2A, GIT2 coding downstream 263717 824939 ~ 853754 (+)
CI01000071_00867024_00871868 NA coding downstream 305619 866841 ~ 873319 (+)
G280372 NA non-coding upstream 791 559968 ~ 560196 (+)
G280236 NA non-coding upstream 322437 238102 ~ 238550 (+)
G280207 NA non-coding upstream 388872 171908 ~ 172115 (+)
G280155 NA non-coding upstream 494310 37532 ~ 66677 (+)
G280152 NA non-coding upstream 535459 25155 ~ 25528 (+)
G280341 NA non-coding downstream 86842 648064 ~ 648656 (+)
G280411 NA non-coding downstream 165431 726653 ~ 727370 (+)
G280413 NA non-coding downstream 176743 737965 ~ 776111 (+)
G280443 NA other downstream 343995 905217 ~ 922096 (+)
CI01000071_01374449_01376813 NA other downstream 813361 1373996 ~ 1377670 (+)
CI01000071_02815324_02834097 NA other downstream 2243422 2815127 ~ 2835525 (+)
G282080 NA other downstream 2494862 3056084 ~ 3056531 (+)

Expression


Co-expression Network