G280740


Basic Information

Item Value
gene id G280740
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000071
NCBI id null
chromosome length 5214881
location 1731131 ~ 1731351 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU318300
TACAAAATCGCATTGCTTCGCTTCAGAAGGCCTTTATTAACCCACTGGAGTCGTATGGATTACTTGTTTTTATGGATGGATGCATTATTTTTGTCTTCAAAAATAATTCACAACCATTATAAACCTTGGAGGACTAAGGATATTTTTAAACATCTCCAATTGTGTTTGCCTGAAAGAAGATAGTCAACACTTAGGATGGCTTGAGGGTGAGTAAATCATGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU318300 True 221 lncRNA 0.36 1 1731131 1731351

Neighbor

gene id symbol gene type direction distance location
CI01000071_01677282_01720849 NA coding upstream 10282 1677282 ~ 1720849 (+)
CI01000071_01580310_01581199 NA coding upstream 149926 1580310 ~ 1581205 (+)
CI01000071_01514470_01525572 NA coding upstream 205536 1514315 ~ 1528807 (+)
CI01000071_01452292_01490229 AACS coding upstream 240219 1450564 ~ 1490912 (+)
CI01000071_01443137_01445109 BRI3BP coding upstream 285965 1443137 ~ 1445166 (+)
CI01000071_01909999_01929819 NA coding downstream 177727 1909078 ~ 1930261 (+)
CI01000071_01966426_01969786 NA coding downstream 234742 1966093 ~ 1969786 (+)
CI01000071_02000540_02048898 NA coding downstream 269034 1993072 ~ 2049583 (+)
CI01000071_02063411_02065517 NA coding downstream 332060 2063411 ~ 2065565 (+)
CI01000071_02105220_02105800 NA coding downstream 373869 2105220 ~ 2106022 (+)
G280695 NA non-coding upstream 213662 1466248 ~ 1517469 (+)
G280705 NA non-coding upstream 234497 1496363 ~ 1496634 (+)
CI01000071_01380924_01388813 RANBP1 non-coding upstream 350228 1380558 ~ 1388948 (+)
G280676 NA non-coding upstream 360152 1357275 ~ 1370979 (+)
G280745 NA non-coding downstream 9540 1740891 ~ 1742345 (+)
G280772 NA non-coding downstream 53265 1784616 ~ 1784816 (+)
G280781 NA non-coding downstream 76725 1808076 ~ 1808304 (+)
G280783 NA non-coding downstream 80272 1811623 ~ 1812051 (+)
G280787 NA non-coding downstream 89853 1821204 ~ 1821479 (+)
CI01000071_01374449_01376813 NA other upstream 353461 1373996 ~ 1377670 (+)
G280443 NA other upstream 809035 905217 ~ 922096 (+)
CI01000071_00792254_00802384 SLC6A4B, SLC6A4 other upstream 927814 791346 ~ 803317 (+)
CI01000071_02815324_02834097 NA other downstream 1073293 2815127 ~ 2835525 (+)
G282080 NA other downstream 1324733 3056084 ~ 3056531 (+)

Expression


Co-expression Network