XLOC_010611 (BX005389.5)


Basic Information

Item Value
gene id XLOC_010611
gene name BX005389.5
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 19626526 ~ 19627832 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00020784
atgctgaagttgccttttgcactctggaatttaagggccgtgttgcagacacaaattgtttgtctgtgctggagaccagaggggaagctgtctttaaaaggatggggctcttataccatatgtgaagttacctattcaggtgctttttgggcacctgtttggagatggaagacagacgaagtcaaagaagcagagaagacacatcaaccagcaagtgtgtaaaattatcaggaaaatgattgactttgaatagacgactgccttatttagcaagaagttttgtctctctctctctcatgtgtatatatatatatatataatgagagacagagagagcgcactctgaagcactgctttttatatgtatgctacatatgatgtcagatttttttatgaatatgttcttatagtattttttgaggcttcacctgcaccttttgaaagttttctgaaatgtttacacagatgtcattaagctgttaaataaatctgtaaaatgtatgtgtgtttgtttttattttgattttagagtcttctcagatcacccaaaaatgaagattcggtcgtcatttacgcatcctcaggttgtttggacacaaagaggattatttgatatttttat

Function

GO:

id name namespace
GO:0044085 cellular component biogenesis biological_process
GO:0022607 cellular component assembly biological_process
GO:0001732 formation of cytoplasmic translation initiation complex biological_process
GO:0071826 ribonucleoprotein complex subunit organization biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0022618 ribonucleoprotein complex assembly biological_process
GO:0065003 protein-containing complex assembly biological_process
GO:0019538 protein metabolic process biological_process
GO:0043603 cellular amide metabolic process biological_process
GO:0043604 amide biosynthetic process biological_process
GO:0030163 protein catabolic process biological_process
GO:1901564 organonitrogen compound metabolic process biological_process
GO:1901565 organonitrogen compound catabolic process biological_process
GO:0009057 macromolecule catabolic process biological_process
GO:1901566 organonitrogen compound biosynthetic process biological_process
GO:0043043 peptide biosynthetic process biological_process
GO:0043632 modification-dependent macromolecule catabolic process biological_process
GO:0006412 translation biological_process
GO:0006413 translational initiation biological_process
GO:0043933 protein-containing complex subunit organization biological_process
GO:0044257 cellular protein catabolic process biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0044265 cellular macromolecule catabolic process biological_process
GO:0044267 cellular protein metabolic process biological_process
GO:0010498 proteasomal protein catabolic process biological_process
GO:0010499 proteasomal ubiquitin-independent protein catabolic process biological_process
GO:0019941 modification-dependent protein catabolic process biological_process
GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process biological_process
GO:0006511 ubiquitin-dependent protein catabolic process biological_process
GO:0006518 peptide metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0051603 proteolysis involved in cellular protein catabolic process biological_process
GO:0034622 cellular protein-containing complex assembly biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:0002181 cytoplasmic translation biological_process
GO:0002183 cytoplasmic translational initiation biological_process
GO:0043248 proteasome assembly biological_process
GO:0071013 catalytic step 2 spliceosome cellular_component
GO:0044391 ribosomal subunit cellular_component
GO:0019773 proteasome core complex, alpha-subunit complex cellular_component
GO:0044424 obsolete intracellular part cellular_component
GO:1990904 ribonucleoprotein complex cellular_component
GO:0044444 obsolete cytoplasmic part cellular_component
GO:0005829 cytosol cellular_component
GO:0005839 proteasome core complex cellular_component
GO:0005840 ribosome cellular_component
GO:0005852 eukaryotic translation initiation factor 3 complex cellular_component
GO:0005854 nascent polypeptide-associated complex cellular_component
GO:0030532 small nuclear ribonucleoprotein complex cellular_component
GO:1905368 peptidase complex cellular_component
GO:1905369 endopeptidase complex cellular_component
GO:0032991 protein-containing complex cellular_component
GO:0015934 large ribosomal subunit cellular_component
GO:0005622 intracellular anatomical structure cellular_component
GO:0033290 eukaryotic 48S preinitiation complex cellular_component
GO:0000502 proteasome complex cellular_component
GO:1902494 catalytic complex cellular_component
GO:0016282 eukaryotic 43S preinitiation complex cellular_component
GO:0005685 U1 snRNP cellular_component
GO:0097525 spliceosomal snRNP complex cellular_component
GO:0070993 translation preinitiation complex cellular_component
GO:0005737 cytoplasm cellular_component
GO:0008135 translation factor activity, RNA binding molecular_function
GO:0070003 threonine-type peptidase activity molecular_function
GO:0004298 threonine-type endopeptidase activity molecular_function
GO:0003723 RNA binding molecular_function
GO:0003735 structural constituent of ribosome molecular_function
GO:0003743 translation initiation factor activity molecular_function
GO:0051082 unfolded protein binding molecular_function

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000117716

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00020784 True 622 lncRNA 0.36 3 19626526 19627832

Neighbor

gene id symbol gene type direction distance location
XLOC_010610 BX005389.2 coding downstream 7927 19617088 ~ 19618599 (-)
XLOC_010609 abcb5 coding downstream 57731 19537038 ~ 19568795 (-)
XLOC_010608 NA coding downstream 128722 19495744 ~ 19497804 (-)
XLOC_010607 BX005032.1 coding downstream 202393 19422295 ~ 19424133 (-)
XLOC_010605 dnah11 coding downstream 253216 19181163 ~ 19373310 (-)
XLOC_010612 BX005389.3 coding upstream 3582 19631414 ~ 19634470 (-)
XLOC_010613 NA coding upstream 179696 19807528 ~ 19821312 (-)
XLOC_010614 NA coding upstream 183802 19811634 ~ 19813802 (-)
XLOC_010615 CU855948.1 coding upstream 200544 19828376 ~ 19834469 (-)
XLOC_010616 hdac9b coding upstream 212314 19840146 ~ 20006270 (-)
XLOC_010626 CR392024.2 misc upstream 1267280 20895112 ~ 20895175 (-)
XLOC_010606 CR936240.1 non-coding downstream 435895 19190514 ~ 19190631 (-)
XLOC_010604 CR936240.2 non-coding downstream 475783 19145147 ~ 19150743 (-)
XLOC_010618 BX511151.1 non-coding upstream 414025 20041857 ~ 20043276 (-)

Expression


Co-expression Network