CI01000075_01364135_01365758 (EEF2B, EEF2L2, EEF2.2, EF2, EEF2)


Basic Information

Item Value
gene id CI01000075_01364135_01365758
gene name EEF2B, EEF2L2, EEF2.2, EF2, EEF2
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000075
NCBI id null
chromosome length 1642109
location 1364122 ~ 1365843 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000075_01364135_01365758.mRNA
ATGGGACGTTATGTCGAGCCCATCGAAGACGTGCCATGCGGTAACATCGTGGGTCTGGTTGGCGTAGACCAGTTCTTGGTGAAGACCGGGACCATCACGACCTTCGAGCAGGCCCACAACATGCGTGTGATGAAGTTCAGCGTCAGCCCTGTGGTCAGAGTGGCAGTGGAGGCCAAGAATCCTGCTGACCTGCCCAAACTAGTGGAGGGACTCAAACGCCTGGCCAAGTCCGACCCCATGGTGCAGTGTATCATTGAGGAGTCTGGAGAGCACATCATCGCTGGCGCTGGAGAACTTCACCTGGAAATCTGCCTTAAAGATCTGGAGGAGGACCATGCGTGCATTCCACTTAAGAAATCAGACCCTGTTGTGTCATACAGGGAGACGGTCAGTGCAGAATCAGACCAGATGTGTTTGTCCAAATCCCCCAACAAGCACAACCGTCTGTACATGAAGGCCAGGCCGTTCCCCGACGGTCTCGCTGAAGACATCGACAAGGGCGAGGTGACGTCCCGTCAGGAGCTCAAGGCCCGCGCCCGTTACTTGGCCGACAAATACGAGTGGGAGGTCACAGAGGCCCGTAAGATCTGGTGCTTCGGACCTGACGGAACCGGACCCAACGTCCTGGTGGACGTGACCAAGGGAGTGCAGTACCTGAACGAGATCAAGGACAGCGTCGTGGCTGGATTCCAGTGGGCCACTAAAGAGGTGAGAGATGTTCAGAATGAAGTGAGGTTTGGTTTGAATGGTCCTGTTGATGTCCTGGCTGGTCTATGAGGAGAAATCATGCACCACTCTGATGAAGTGATGGATAACCCCTACCACAAACATCTGAGACCTCCACAGACATGAACACATTCAA

Function

symbol description
eef2b Predicted to enable GTPase activity; ribosome binding activity; and translation elongation factor activity. Acts upstream of or within cellular response to xenobiotic stimulus and chordate embryonic development. Predicted to be part of ribonucleoprotein complex. Predicted to be active in cytosol. Is expressed in several structures, including epidermis; immature eye; nervous system; tail bud; and trunk. Human ortholog(s) of this gene implicated in glaucoma and spinocerebellar ataxia type 26. Orthologous to human EEF2 (eukaryotic translation elongation factor 2).
eef2l2 Predicted to enable GTPase activity; ribosome binding activity; and translation elongation factor activity. Predicted to be involved in translational elongation. Predicted to act upstream of or within translation. Predicted to be part of ribonucleoprotein complex. Predicted to be active in cytosol. Is expressed in brain and musculature system. Human ortholog(s) of this gene implicated in glaucoma and spinocerebellar ataxia type 26. Orthologous to human EEF2 (eukaryotic translation elongation factor 2).
eef2 Enables protein kinase binding activity and ribosome binding activity. Involved in positive regulation of translation. Located in aggresome; cytosol; and plasma membrane. Part of ribonucleoprotein complex. Implicated in glaucoma and spinocerebellar ataxia type 26. Biomarker of Alzheimer's disease.

GO:

id name namespace
GO:0016235 aggresome cellular_component

KEGG:

id description
K03234 EEF2; elongation factor 2

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000075_01364135_01365758.mRNA False 862 mRNA 0.55 2 1364135 1365843

Neighbor

gene id symbol gene type direction distance location
CI01000075_01159479_01160597 KLF2B coding upstream 203472 1159479 ~ 1160663 (+)
CI01000075_01033320_01042574 AP1M1.S, AP1M1 coding upstream 320440 1033220 ~ 1043695 (+)
CI01000075_01015651_01022674 NA coding upstream 341322 1015651 ~ 1022813 (+)
CI01000075_00917306_00921588 NA coding upstream 442415 917306 ~ 922416 (+)
CI01000075_00877796_00880322 NA coding upstream 483691 877796 ~ 880444 (+)
CI01000075_01404076_01444348 UNC13A coding downstream 38233 1404076 ~ 1444410 (+)
CI01000075_01451280_01460210 RAB11B.2.L, RB11B, RAB11B.1.S, RAB11B.2, RAB11B.1, RAB11B, RAB11BA, RAB11BB coding downstream 85437 1451280 ~ 1461636 (+)
CI01000075_01466937_01467865 NA coding downstream 101094 1466937 ~ 1468061 (+)
CI01000075_01506719_01516006 NA coding downstream 140367 1505543 ~ 1516053 (+)
CI01000075_01526289_01529484 POLR2E, POLR2EA, POLR2EB coding downstream 160398 1526241 ~ 1529656 (+)
G289334 NA non-coding upstream 47090 1295309 ~ 1317045 (+)
G289339 NA non-coding upstream 50327 1311275 ~ 1313808 (+)
G289351 NA non-coding upstream 92089 1271786 ~ 1272046 (+)
G289309 NA non-coding upstream 96576 1218359 ~ 1267559 (+)
G289280 NA non-coding upstream 164553 1190069 ~ 1199582 (+)
G289367 NA non-coding downstream 3274 1369117 ~ 1369541 (+)
G289377 NA non-coding downstream 79263 1445106 ~ 1445310 (+)
G289378 NA non-coding downstream 79647 1445490 ~ 1445868 (+)
G289379 NA non-coding downstream 81202 1447045 ~ 1447257 (+)
G289340 NA non-coding downstream 99594 1465437 ~ 1466391 (+)
G288755 NA other upstream 1056214 305108 ~ 316301 (+)
G288708 NA other upstream 1126864 235398 ~ 237271 (+)
G289319 NA other downstream 234338 1600181 ~ 1605306 (+)

Expression


Co-expression Network