G288905


Basic Information

Item Value
gene id G288905
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000075
NCBI id null
chromosome length 1642109
location 726571 ~ 726815 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU327645
CAAAGACGTTCTTCATTGTGATGACGAAAACGTTGTAAGCTATAAGGAAGTCCCAGTAACGGAGGATCTTCTTTATTGGCTTGAGTAAGAGATCGCCCCCAAAGAGCAGGAAGTAAAAACACGCCACTAGGTAACCCATGCAGAAGATGCTGATCCGAGTCGTGCCCGTGATGAAGATGATGGTCAGGACGAACCAGAACAGGTAGCTAAACATGATCACCTTCAGCATGTCCAGGTATGACCTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU327645 True 245 lncRNA 0.47 1 726571 726815

Neighbor

gene id symbol gene type direction distance location
CI01000075_00682733_00683937 NA coding upstream 41999 682483 ~ 685507 (+)
CI01000075_00656048_00662437 NAPG coding upstream 62820 656009 ~ 663751 (+)
CI01000075_00548373_00566336 ACSS2L coding upstream 160088 548373 ~ 566483 (+)
CI01000075_00500237_00500551 NA coding upstream 225899 499709 ~ 500672 (+)
CI01000075_00293769_00296813 NA coding upstream 429486 293769 ~ 297085 (+)
CI01000075_00800884_00806063 NA coding downstream 73965 800780 ~ 806474 (+)
CI01000075_00821649_00821906 NA coding downstream 94834 821498 ~ 825595 (+)
CI01000075_00864628_00867240 NA coding downstream 137214 864029 ~ 868077 (+)
CI01000075_00877796_00880322 NA coding downstream 150981 877796 ~ 880444 (+)
CI01000075_00917306_00921588 NA coding downstream 190491 917306 ~ 922416 (+)
G288870 NA non-coding upstream 126134 594128 ~ 600437 (+)
G288838 NA non-coding upstream 149383 574285 ~ 577188 (+)
G288793 NA non-coding upstream 247085 474588 ~ 479486 (+)
G288805 NA non-coding upstream 271585 453493 ~ 454986 (+)
G288918 NA non-coding downstream 61956 788771 ~ 826689 (+)
G288948 NA non-coding downstream 145583 872398 ~ 872855 (+)
G288956 NA non-coding downstream 186830 913645 ~ 913925 (+)
G288916 NA non-coding downstream 213935 940750 ~ 941054 (+)
G288755 NA other upstream 418650 305108 ~ 316301 (+)
G288708 NA other upstream 489300 235398 ~ 237271 (+)
CI01000075_01364135_01365758 EEF2B, EEF2L2, EEF2.2, EF2, EEF2 other downstream 601971 1364122 ~ 1365843 (+)
CI01000075_01404076_01444348 UNC13A other downstream 657228 1404076 ~ 1444410 (+)
G289319 NA other downstream 873366 1600181 ~ 1605306 (+)

Expression


Co-expression Network