G289398



Basic Information


Item Value
gene id G289398
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000075
NCBI id null
chromosome length 1642109
location 1530353 ~ 1530598 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU328229
AGGAAACATGACACTTTAAGAGTCGGGGGGTGAAAACTTTTTGAATTCGAAGATCAAGGTAAATTGTACTTAATCTGTCTTCTGGGAAACATGTAACTATCCTCTGTTGCTTCCGAAGGGCAGTACTAAATGAAGAAAAATTATATTTAAACAAAAAAAGAAAAATGTGAACATCTTCATCCTGTTCAAAAGTTTTCACCCCCCTGACTCAATGTATCGTGTTTCCTTCTGGAGCATCAGTGAATG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU328229 True 246 lncRNA 0.37 1 1530353 1530598

Neighbor


gene id symbol gene type direction distance location
CI01000075_01526289_01529484 POLR2E, POLR2EA, POLR2EB coding upstream 697 1526241 ~ 1529656 (+)
CI01000075_01506719_01516006 NA coding upstream 14300 1505543 ~ 1516053 (+)
CI01000075_01466937_01467865 NA coding upstream 62292 1466937 ~ 1468061 (+)
CI01000075_01451280_01460210 RAB11B.2.L, RB11B, RAB11B.1.S, RAB11B.2, RAB11B.1, RAB11B, RAB11BA, RAB11BB coding upstream 68717 1451280 ~ 1461636 (+)
CI01000075_01404076_01444348 UNC13A coding upstream 85943 1404076 ~ 1444410 (+)
CI01000075_01609077_01609286 NA coding downstream 78479 1609077 ~ 1610221 (+)
G289329 NA non-coding upstream 5491 1518990 ~ 1524862 (+)
G289397 NA non-coding upstream 13748 1516324 ~ 1516605 (+)
G289390 NA non-coding upstream 26450 1494413 ~ 1503903 (+)
G289340 NA non-coding upstream 63962 1465437 ~ 1466391 (+)
G289401 NA non-coding downstream 13065 1543663 ~ 1545087 (+)
G289402 NA non-coding downstream 14885 1545483 ~ 1547588 (+)
G289400 NA non-coding downstream 30693 1561291 ~ 1567304 (+)
CI01000075_01364135_01365758 EEF2B, EEF2L2, EEF2.2, EF2, EEF2 other upstream 164663 1364122 ~ 1365843 (+)
CI01000075_00917306_00921588 NA other upstream 607937 917306 ~ 922416 (+)
G288755 NA other upstream 1222432 305108 ~ 316301 (+)
G288708 NA other upstream 1293082 235398 ~ 237271 (+)
G289319 NA other downstream 69583 1600181 ~ 1605306 (+)

Expression



Co-expression Network