CI01000080_03460127_03482686 (T2FB, GTF2F2A, GTF2F2B, GTF2F2)


Basic Information

Item Value
gene id CI01000080_03460127_03482686
gene name T2FB, GTF2F2A, GTF2F2B, GTF2F2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000080
NCBI id null
chromosome length 5175454
location 3460127 ~ 3482686 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000080_03460127_03482686.mRNA
ATGTCAGACAAAGGACAAGACGTCGATTTAACTAGAGCCAAACAAAACACGGGAGTCTGGCTAGTGAAGGTTCCCAAATATCTCTCTCAGCAGTGGGCAAAAGCATCTGGGCGAGGAGAAGTTGGCAAACTTAAAATTGGGAAAGCTCAAGGAAAGACTGTGGTGTCTTTCAATCTAAGTGAGGATCTGACAGTTGTGGAGTGCTCCGGGGAGAAGGTTTCATCGGTGCGCAGCCCTAGAGAACATCCCTTCACCATGCAGACGGTGGGAGGTCAGAGCCTCGCTGTCTTTACTGAGAGTTCAGACAAGCTGGCTCTTGAAGGCATGGTTGTGCAGCGAGCTGAATGCAGACCTGCGGTCAGTGAGAGCTACATGAAATTAAAGAAGCTGCAGATTGAAGAATCCACCAAACCTCTTCGTTTTTCTCAGAAGCTTGAGAAAGCCGTCACAACAAATTACAAACCTGTGTCCAACCACAGCCATAATGTGGAATATGAGAAGAGAAAGAAAGAGGAAGGCAAGCGTGCAAGAGCTGACAAACAGAAGGTTCTGGAAATGCTCTTCTCTGCCTTTGAGAAGCACCAGTACTACAACATCAGAGACCTGGTGGACATCACAAAGCAACCAGTGATTTACCTGAAGGAGATTCTCAGGGAGATCGGCGTGTACAATTCCAGAGGGCCTCATAAGAGCACCTGGGAGCTGAAACCTGAATATCGCCACTACGAGGAAGGACAAGAGGAGGAGGAGGAAAAAATGGAG

Function

symbol description
gtf2f2a Predicted to enable several functions, including ATP binding activity; DNA binding activity; and DNA helicase activity. Predicted to be involved in transcription initiation from RNA polymerase II promoter. Predicted to act upstream of or within transcription by RNA polymerase II. Predicted to be located in nucleus. Predicted to be part of transcription factor TFIIF complex. Orthologous to human GTF2F2 (general transcription factor IIF subunit 2).
gtf2f2b Predicted to enable several functions, including ATP binding activity; DNA binding activity; and DNA helicase activity. Predicted to be involved in transcription initiation from RNA polymerase II promoter. Predicted to act upstream of or within transcription by RNA polymerase II. Predicted to be located in nucleus. Predicted to be part of transcription factor TFIIF complex. Orthologous to human GTF2F2 (general transcription factor IIF subunit 2).
gtf2f2 Predicted to enable RNA polymerase II general transcription initiation factor activity. Involved in transcription by RNA polymerase II. Located in microtubule cytoskeleton and nucleoplasm. Part of transcription preinitiation complex.

GO:

id name namespace
GO:0016787 hydrolase activity molecular_function

KEGG:

id description
K03139 TFIIF2, GTF2F2, TFG2; transcription initiation factor TFIIF subunit beta

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000080_03460127_03482686.mRNA True 762 mRNA 0.48 8 3460127 3482686

Neighbor

gene id symbol gene type direction distance location
CI01000080_03421006_03421194 NA coding downstream 38933 3420775 ~ 3421194 (-)
CI01000080_03390711_03395563 NA coding downstream 64564 3390627 ~ 3395563 (-)
CI01000080_03309401_03310494 HTR1FA coding downstream 149633 3309337 ~ 3310494 (-)
CI01000080_03259702_03274657 SLC37A1 coding downstream 185470 3259373 ~ 3274657 (-)
CI01000080_03225699_03250598 PDE9A coding downstream 208660 3225567 ~ 3251467 (-)
CI01000080_03546606_03550758 NA coding upstream 63605 3545836 ~ 3550966 (-)
CI01000080_03599356_03610857 LACC1 coding upstream 116437 3599123 ~ 3610942 (-)
CI01000080_03768413_03792359 DNAJC15 coding upstream 285497 3768183 ~ 3792412 (-)
CI01000080_03823638_03839211 NA coding upstream 340747 3823433 ~ 3839456 (-)
CI01000080_03858298_03868014 TNFSF11 coding upstream 375117 3857803 ~ 3868279 (-)
G292623 NA non-coding downstream 6545 3416424 ~ 3453582 (-)
G292606 NA non-coding downstream 36545 3391787 ~ 3423582 (-)
G292596 NA non-coding downstream 73935 3383713 ~ 3386192 (-)
G292590 NA non-coding downstream 80061 3341071 ~ 3380066 (-)
CI01000080_03207204_03212602 NA non-coding downstream 241969 3207204 ~ 3212913 (-)
G292620 NA non-coding upstream 46699 3529385 ~ 3541856 (-)
G292700 NA non-coding upstream 128993 3611679 ~ 3611931 (-)
G292794 NA non-coding upstream 200818 3683504 ~ 3684180 (-)
G292716 NA non-coding upstream 273388 3756074 ~ 3761203 (-)
G292387 NA other downstream 716881 2733587 ~ 2743246 (-)
G292349 NA other downstream 934718 2518078 ~ 2525409 (-)
G292089 NA other downstream 1788207 1635762 ~ 1693395 (-)
G290314 NA other downstream 3051983 407885 ~ 408144 (-)
G292714 NA other upstream 232795 3715481 ~ 3728010 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_037049 gtf2f2b coding NC_007120.7 CM002893.2 18829360 ~ 18905317 (+)