G290199


Basic Information

Item Value
gene id G290199
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000080
NCBI id null
chromosome length 5175454
location 117631 ~ 117892 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU329182
TTATCTTCTGCCAGACCGCCTTCCGTATTCAATGTACGAAGAAAGTGTGACGCCTTTCGCAGTTCAAAATGGTTACGCAACGTCCTACGCCTTCCCTATTCAACTTACGGAAAAAGTGTAACTGATGCAACGCCAGTTTACACTTCCTTCTTAAGTTGAATACGGAAGGCGGTCTGGCGGAAGCTAGATATTTTACTTCATAACTTGTTATTTTTTTGCACAAACGCATCACTTCACTTCAGAAGGACTTTATTAACCCCCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU329182 True 262 lncRNA 0.43 1 117631 117892

Neighbor

gene id symbol gene type direction distance location
CI01000080_00103467_00104168 NA coding downstream 13443 103316 ~ 104188 (-)
CI01000080_00000621_00005854 MCTP1A, MCTP1 coding downstream 111777 547 ~ 5854 (-)
CI01000080_00118423_00142677 TTC37 coding upstream 531 118423 ~ 142677 (-)
CI01000080_00202124_00211154 HMGCR, HMGCRA coding upstream 84049 201941 ~ 211154 (-)
CI01000080_00292016_00307681 CCDC180 coding upstream 173854 290561 ~ 307681 (-)
CI01000080_00309567_00317169 CARD9 coding upstream 190154 308046 ~ 317669 (-)
CI01000080_00318151_00318865 NA coding upstream 199992 317884 ~ 318865 (-)
G290191 NA non-coding downstream 132 114365 ~ 117499 (-)
G290211 NA non-coding downstream 54325 44265 ~ 63306 (-)
G290209 NA non-coding downstream 89396 25470 ~ 28235 (-)
G290194 NA non-coding upstream 25257 143149 ~ 152646 (-)
G290202 NA non-coding upstream 42632 160524 ~ 160865 (-)
G290222 NA non-coding upstream 43465 161357 ~ 161932 (-)
G290224 NA non-coding upstream 45776 163668 ~ 163876 (-)
G290223 NA non-coding upstream 46290 164182 ~ 164394 (-)
G290197 NA other upstream 154505 272397 ~ 279847 (-)
G290261 NA other upstream 208901 327689 ~ 329517 (-)
G290314 NA other upstream 289993 407885 ~ 408144 (-)
G292089 NA other upstream 1517870 1635762 ~ 1693395 (-)
G292349 NA other upstream 2400186 2518078 ~ 2525409 (-)

Expression


Co-expression Network