G290202


Basic Information

Item Value
gene id G290202
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000080
NCBI id null
chromosome length 5175454
location 160524 ~ 160865 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU329185
GTCATGTGATGTCCAGCTCGGATACATGCAGTGAGCGTTCATATGAAAAATCAACACTAATAACACACGGAACATGAGCATGTTTCTACATCCAGATGCCAGCAGAGTCTTAAAAACGACTTTTAAAGACGACGAAGGTTTGAAAATGAGACTTCTTTGCGTCTTCTCTCCTTAAGAAGCGATGACCGCTCTGCATATCCAATGAAATCCCACTATCACTGACATGTCCATTTACACATAACATTAGAAGGCCGTATTATGTCGGTTTAGTTTAGTTACTATTTTCCTCGAGTAATCTGTAATATGCAAGTTCATTTTTAAAGATATCCCTTCATCTTTTCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU329185 True 342 lncRNA 0.39 1 160524 160865

Neighbor

gene id symbol gene type direction distance location
CI01000080_00118423_00142677 TTC37 coding downstream 17847 118423 ~ 142677 (-)
CI01000080_00103467_00104168 NA coding downstream 56336 103316 ~ 104188 (-)
CI01000080_00000621_00005854 MCTP1A, MCTP1 coding downstream 154670 547 ~ 5854 (-)
CI01000080_00202124_00211154 HMGCR, HMGCRA coding upstream 41076 201941 ~ 211154 (-)
CI01000080_00292016_00307681 CCDC180 coding upstream 130881 290561 ~ 307681 (-)
CI01000080_00309567_00317169 CARD9 coding upstream 147181 308046 ~ 317669 (-)
CI01000080_00318151_00318865 NA coding upstream 157019 317884 ~ 318865 (-)
CI01000080_00319743_00328159 NA coding upstream 158878 319743 ~ 328159 (-)
G290194 NA non-coding downstream 7878 143149 ~ 152646 (-)
G290199 NA non-coding downstream 42632 117631 ~ 117892 (-)
G290191 NA non-coding downstream 43025 114365 ~ 117499 (-)
G290211 NA non-coding downstream 97218 44265 ~ 63306 (-)
G290209 NA non-coding downstream 132289 25470 ~ 28235 (-)
G290222 NA non-coding upstream 492 161357 ~ 161932 (-)
G290224 NA non-coding upstream 2803 163668 ~ 163876 (-)
G290223 NA non-coding upstream 3317 164182 ~ 164394 (-)
G290205 NA non-coding upstream 3706 164571 ~ 165474 (-)
G290203 NA non-coding upstream 37844 198709 ~ 199619 (-)
G290197 NA other upstream 111532 272397 ~ 279847 (-)
G290261 NA other upstream 165928 327689 ~ 329517 (-)
G290314 NA other upstream 247020 407885 ~ 408144 (-)
G292089 NA other upstream 1474897 1635762 ~ 1693395 (-)
G292349 NA other upstream 2357213 2518078 ~ 2525409 (-)

Expression


Co-expression Network