G290528


Basic Information

Item Value
gene id G290528
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000080
NCBI id null
chromosome length 5175454
location 568553 ~ 568756 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU329546
TTATGCACCCCCATACCATCAGAGATGCTGGCTTTTGAACTGAACGCTGATAACACGCTGGAAGGTCTCCCTCCTCTTTAGCCCGGAGGACACGGCGTCCGTGATTTCCAACAAGAATGTCAAATTTGGACTCGTCTGACCATAGAACACTTTTCCACTTTGAAACAGTCCATTTTAAATGAGCCTTGGCCCACAGGACACGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU329546 True 204 lncRNA 0.49 1 568553 568756

Neighbor

gene id symbol gene type direction distance location
CI01000080_00521848_00524367 OTP, OTPA, OTPB coding downstream 44163 521081 ~ 524390 (-)
CI01000080_00330537_00333221 NA coding downstream 235332 330242 ~ 333221 (-)
CI01000080_00328119_00328700 NA coding downstream 239853 328119 ~ 328700 (-)
CI01000080_00319743_00328159 NA coding downstream 240394 319743 ~ 328159 (-)
CI01000080_00318151_00318865 NA coding downstream 249688 317884 ~ 318865 (-)
CI01000080_00597523_00605227 LHFPL2B coding upstream 28559 597315 ~ 606452 (-)
CI01000080_00614889_00638900 HOMER1, HOMER1B coding upstream 45106 613862 ~ 640684 (-)
CI01000080_00670914_00678760 MTX3 coding upstream 101993 670749 ~ 678760 (-)
CI01000080_00699809_00719764 SERINC5 coding upstream 130869 699625 ~ 719764 (-)
CI01000080_00737755_00742405 CDK7 coding upstream 168755 737511 ~ 742647 (-)
G290362 NA non-coding downstream 65145 502326 ~ 503408 (-)
G290361 NA non-coding downstream 66486 501804 ~ 502067 (-)
G290360 NA non-coding downstream 66915 500389 ~ 501638 (-)
CI01000080_00292016_00307681 CCDC180 non-coding downstream 270556 290561 ~ 307681 (-)
G290258 NA non-coding downstream 303105 264677 ~ 265448 (-)
G290529 NA non-coding upstream 12703 581459 ~ 581692 (-)
G290530 NA non-coding upstream 13100 581856 ~ 582134 (-)
G290535 NA non-coding upstream 42262 611018 ~ 611226 (-)
G290517 NA non-coding upstream 77496 646252 ~ 647515 (-)
G290522 NA non-coding upstream 161244 730000 ~ 735161 (-)
G290314 NA other downstream 160409 407885 ~ 408144 (-)
G290261 NA other downstream 239036 327689 ~ 329517 (-)
G290197 NA other downstream 288706 272397 ~ 279847 (-)
G292089 NA other upstream 1067006 1635762 ~ 1693395 (-)
G292349 NA other upstream 1949322 2518078 ~ 2525409 (-)
G292387 NA other upstream 2164831 2733587 ~ 2743246 (-)
CI01000080_03207204_03212602 NA other upstream 2640229 3207204 ~ 3212913 (-)
G292714 NA other upstream 3146725 3715481 ~ 3728010 (-)

Expression


Co-expression Network