G292123



Basic Information


Item Value
gene id G292123
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000080
NCBI id null
chromosome length 5175454
location 1691380 ~ 1691674 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU331457
TGGTAGCATCATAGTCTGAGGCTGCATGAGCGCTGCTGGGACTGGGGAACTGCACTTCATTGAGGGAAACATGGATTCCAACATGTACTGTGACATTCTGAAGCAGAACATGATGCGATGGAGTGGCCAAGTATGTCTCCAGACCTGAACCCTATTGAGCACCTGTGGGGCATCCTCAAGCGGAAGGTGGAGAAGCGCCA

Function


NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU331457 True 200 lncRNA 0.53 2 1691380 1691674

Neighbor


gene id symbol gene type direction distance location
CI01000080_01584991_01585618 NA coding downstream 105671 1583859 ~ 1585709 (-)
CI01000080_01542470_01546061 TMEM8C coding downstream 144597 1542239 ~ 1546783 (-)
CI01000080_01514171_01520784 SLC2A8 coding downstream 170542 1514136 ~ 1520838 (-)
CI01000080_01500308_01505160 NA coding downstream 185966 1499877 ~ 1505414 (-)
CI01000080_01442459_01464557 JAK2B coding downstream 224374 1441985 ~ 1467006 (-)
CI01000080_01726615_01730435 NA coding upstream 34315 1725989 ~ 1730435 (-)
CI01000080_01732531_01763618 KCNT1 coding upstream 40716 1732390 ~ 1763618 (-)
CI01000080_01954854_01959161 CFAP157 coding upstream 263017 1954691 ~ 1959324 (-)
CI01000080_01980939_01981859 NA coding upstream 288630 1979746 ~ 1982199 (-)
CI01000080_01987220_01990307 PTRH1 coding upstream 294824 1986498 ~ 1990697 (-)
G292114 NA non-coding downstream 43136 1647565 ~ 1648244 (-)
G292085 NA non-coding downstream 59108 1632064 ~ 1632272 (-)
G292050 NA non-coding downstream 178775 1512333 ~ 1512605 (-)
G292044 NA non-coding downstream 196441 1494581 ~ 1494939 (-)
G292043 NA non-coding downstream 198577 1490295 ~ 1492803 (-)
G292103 NA non-coding upstream 30624 1722298 ~ 1723134 (-)
G292099 NA non-coding upstream 31675 1723349 ~ 1724367 (-)
G292102 NA non-coding upstream 33021 1724695 ~ 1725025 (-)
G292096 NA non-coding upstream 120737 1812411 ~ 1812972 (-)
G292176 NA non-coding upstream 270864 1962538 ~ 1966566 (-)
G292089 NA other downstream 19460 1635762 ~ 1693395 (-)
G290314 NA other downstream 1283236 407885 ~ 408144 (-)
G290261 NA other downstream 1361863 327689 ~ 329517 (-)
G290197 NA other downstream 1411533 272397 ~ 279847 (-)
G292349 NA other upstream 826404 2518078 ~ 2525409 (-)
G292387 NA other upstream 1041913 2733587 ~ 2743246 (-)
CI01000080_03207204_03212602 NA other upstream 1517311 3207204 ~ 3212913 (-)
G292714 NA other upstream 2023807 3715481 ~ 3728010 (-)

Expression



Co-expression Network