G292505


Basic Information

Item Value
gene id G292505
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000080
NCBI id null
chromosome length 5175454
location 3059096 ~ 3059348 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU331924
GGCGTTTACGAGTTTACACCAAAGATCCAGGCAAGACAAGATTAAACTTACTTGCAAAAGAATTGCCTACAACATTCTAAAATCTGCCAAGTTAATGCGACATGTAAGCTATGTATAGTTTCTTTTGCAACGTATTTTTCCAGTCACAGACCAGCGCTCAAGCTCTGACTAGAATCAGCATTCACGTGCACAAAAATTTGTTTCGCGCTGCGGCGCTGACAACAATCTGGTGGTGGCTAGAATCACACAGCGG

Function

NR:

description
pogo transposable element with KRAB domain

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU331924 True 253 lncRNA 0.43 1 3059096 3059348

Neighbor

gene id symbol gene type direction distance location
CI01000080_02998252_03001018 NA coding downstream 57423 2998108 ~ 3001673 (-)
CI01000080_02901179_02916041 NA coding downstream 141453 2901115 ~ 2917643 (-)
CI01000080_02890744_02893801 BRAFLDRAFT_57441, RAB14L, RAB14 coding downstream 165295 2890534 ~ 2893801 (-)
CI01000080_02675714_02724087 DNM1A, DNM1, DNM1B coding downstream 335009 2675714 ~ 2724087 (-)
CI01000080_02626826_02665868 NA coding downstream 393228 2626586 ~ 2665868 (-)
CI01000080_03135523_03147452 PDXKA, PDXK coding upstream 75664 3135012 ~ 3147452 (-)
CI01000080_03187019_03196643 PKNOX1.1 coding upstream 127143 3186491 ~ 3196643 (-)
CI01000080_03199317_03204484 NA coding upstream 139852 3199200 ~ 3204484 (-)
CI01000080_03207204_03212602 NA coding upstream 147856 3207204 ~ 3212913 (-)
CI01000080_03225699_03250598 PDE9A coding upstream 166219 3225567 ~ 3251467 (-)
G292503 NA non-coding downstream 6241 3052638 ~ 3052855 (-)
G292498 NA non-coding downstream 26755 3031562 ~ 3032341 (-)
G292496 NA non-coding downstream 30586 3028301 ~ 3028510 (-)
G292486 NA non-coding downstream 74687 2983926 ~ 2984409 (-)
G292470 NA non-coding downstream 115525 2943228 ~ 2943571 (-)
G292506 NA non-coding upstream 857 3060205 ~ 3060404 (-)
G292554 NA non-coding upstream 68400 3127748 ~ 3128259 (-)
G292557 NA non-coding upstream 108439 3167787 ~ 3168032 (-)
G292558 NA non-coding upstream 109214 3168562 ~ 3168798 (-)
G292560 NA non-coding upstream 111105 3170453 ~ 3171145 (-)
G292387 NA other downstream 315850 2733587 ~ 2743246 (-)
G292349 NA other downstream 533687 2518078 ~ 2525409 (-)
G292089 NA other downstream 1387176 1635762 ~ 1693395 (-)
G290314 NA other downstream 2650952 407885 ~ 408144 (-)
G290261 NA other downstream 2729579 327689 ~ 329517 (-)
G292714 NA other upstream 656133 3715481 ~ 3728010 (-)

Expression


Co-expression Network