G292868


Basic Information

Item Value
gene id G292868
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000080
NCBI id null
chromosome length 5175454
location 4026360 ~ 4028482 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU332374
GAGCTATTGTTCTTGTTTGACACACATCAACTTTCTAGTTCAAAGTGCATTTGCTCCAAGAGGGTGGCCACAGGAAGTTGCCTGTGTACCTTGGCTCCGATCAGACAAATGTCTTTGACGAGGTGGGACTGCATCATCTCAGCCAGCAGGCGGTCGTGGGTGGGGGTGCCGATGAACGCGGGACTGCTGTTGGGCGGGCGAATTGGCCGCGTCCCTGAAGGAACCTGAAAGGTGATGTTCTGGTTGGCGATGTTGAGCGTGACGGCTGCCTGTTCTGCATGATCTCCACTCACAGGCTCTACTTTCACCACTGCAGTCGGAGAAGGCTTTGTGCTCCCATCAGTCAACTCAAACCTACTGAGCACCCCCTCTACGGCGGTGCGGCCTTCCTTTCCCAGCATGGCCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU332374 True 406 lncRNA 0.56 3 4026360 4028482

Neighbor

gene id symbol gene type direction distance location
CI01000080_04006295_04009794 NA coding downstream 16566 4006181 ~ 4009794 (-)
CI01000080_03972165_03981008 NA coding downstream 43595 3972131 ~ 3982765 (-)
CI01000080_03925953_03961599 DGKH coding downstream 64543 3925530 ~ 3961817 (-)
CI01000080_03882251_03905283 AKAP11 coding downstream 121077 3882215 ~ 3905283 (-)
CI01000080_03871122_03871424 NA coding downstream 154475 3870817 ~ 3871885 (-)
CI01000080_04185680_04192219 RGCC coding upstream 156664 4185146 ~ 4192219 (-)
CI01000080_04196209_04198578 NA coding upstream 166580 4195062 ~ 4198578 (-)
CI01000080_04199562_04201445 KBTBD7 coding upstream 170785 4199267 ~ 4201597 (-)
CI01000080_04226079_04237658 SLAIN1A coding upstream 197546 4226028 ~ 4237658 (-)
CI01000080_04239679_04243440 NA coding upstream 210903 4239385 ~ 4243440 (-)
G292863 NA non-coding downstream 3990 4021895 ~ 4022370 (-)
G292843 NA non-coding downstream 156847 3869307 ~ 3869513 (-)
G292833 NA non-coding downstream 188182 3837979 ~ 3838178 (-)
CI01000080_03823638_03839211 NA non-coding downstream 199190 3823433 ~ 3839456 (-)
G292726 NA non-coding downstream 263243 3762147 ~ 3763117 (-)
G292905 NA non-coding upstream 109148 4137630 ~ 4140895 (-)
G292907 NA non-coding upstream 112591 4141073 ~ 4141365 (-)
G292906 NA non-coding upstream 113132 4141614 ~ 4142126 (-)
G292947 NA non-coding upstream 136299 4164781 ~ 4165003 (-)
G292949 NA non-coding upstream 138386 4166868 ~ 4167428 (-)
G292714 NA other downstream 298350 3715481 ~ 3728010 (-)
CI01000080_03207204_03212602 NA other downstream 807957 3207204 ~ 3212913 (-)
G292387 NA other downstream 1283114 2733587 ~ 2743246 (-)
G292349 NA other downstream 1500951 2518078 ~ 2525409 (-)
G292089 NA other downstream 2354440 1635762 ~ 1693395 (-)

Expression


Co-expression Network