G292969



Basic Information


Item Value
gene id G292969
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000080
NCBI id null
chromosome length 5175454
location 4216817 ~ 4217152 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU332481
TAAAGGAGGCAGCATGGCAAACAATCAATCTCTCATTACAAACATACTAGCTGGACTGTGGAGTTACATTTTATGGACTTACCTTTCCAGCAAATCACATCACTCTTCGTTGGATTATCACTTCTGTGGACTTTGTATATACACCAGTGGACACTTTCACATTGGGACTTACATCACGCTAGGATTCTTATGGACTGTTTTAGGGTATGGTGCAAACGGACTCCACACTTTTAACAGCCTAAGTTATTCTAGTTTTATTGTGTTGTTTTAAGTTCCTTGTGAATATTGTAAATACACCTTATTTATTAATTTCTGTTGTCTGTCTCATCTTTTTAA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU332481 True 336 lncRNA 0.36 1 4216817 4217152

Neighbor


gene id symbol gene type direction distance location
CI01000080_04199562_04201445 KBTBD7 coding downstream 15220 4199267 ~ 4201597 (-)
CI01000080_04196209_04198578 NA coding downstream 18239 4195062 ~ 4198578 (-)
CI01000080_04185680_04192219 RGCC coding downstream 24598 4185146 ~ 4192219 (-)
CI01000080_04006295_04009794 NA coding downstream 207023 4006181 ~ 4009794 (-)
CI01000080_03972165_03981008 NA coding downstream 234052 3972131 ~ 3982765 (-)
CI01000080_04226079_04237658 SLAIN1A coding upstream 8876 4226028 ~ 4237658 (-)
CI01000080_04239679_04243440 NA coding upstream 22233 4239385 ~ 4243440 (-)
CI01000080_04380060_04382833 CLN5 coding upstream 162875 4380027 ~ 4382833 (-)
CI01000080_04488197_04502798 NA coding upstream 270679 4487831 ~ 4504534 (-)
CI01000080_04517413_04566482 EPHA3 coding upstream 299753 4516905 ~ 4566695 (-)
G292968 NA non-coding downstream 241 4216163 ~ 4216576 (-)
G292967 NA non-coding downstream 21944 4194584 ~ 4194873 (-)
G292954 NA non-coding downstream 38963 4177509 ~ 4177854 (-)
G292951 NA non-coding downstream 45967 4170589 ~ 4170850 (-)
G292949 NA non-coding downstream 49389 4166868 ~ 4167428 (-)
G292975 NA non-coding upstream 433 4217585 ~ 4218008 (-)
G293021 NA non-coding upstream 101901 4319053 ~ 4321673 (-)
G293056 NA non-coding upstream 215397 4432549 ~ 4432819 (-)
G293085 NA non-coding upstream 284004 4501156 ~ 4501434 (-)
G293093 NA non-coding upstream 419949 4637101 ~ 4637336 (-)
G292714 NA other downstream 488807 3715481 ~ 3728010 (-)
CI01000080_03207204_03212602 NA other downstream 998414 3207204 ~ 3212913 (-)
G292387 NA other downstream 1473571 2733587 ~ 2743246 (-)
G292349 NA other downstream 1691408 2518078 ~ 2525409 (-)
G292089 NA other downstream 2544897 1635762 ~ 1693395 (-)

Expression



Co-expression Network