CI01000082_00847325_00903986 (HS6ST1B, HS6ST1, HS6ST1A)


Basic Information

Item Value
gene id CI01000082_00847325_00903986
gene name HS6ST1B, HS6ST1, HS6ST1A
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000082
NCBI id null
chromosome length 5120761
location 847325 ~ 903986 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000082_00847325_00903986.mRNA
ATGAACGACACGGAAAGGAACATGGTTGAAAGGACCAGTAAATTTCTGTTGATCGTCGTCGGATCGGTCTTCTTCATGCTGATTTTGTACCAGTACGTGGCGCCCGGGGTGATAAACTTCGGCTCCCCGCACGGGTACCTTCTCGGCGAAGAGGACATGACCATTTTCCCCACTCCGGATCCGCACTACGTGAAAAAGTACTACTTCCCTATTAAAGATCTCGAGCGCAACATAGATTTTGAAATCAAGGGGGAAGACGTGATTGTGTTTCTCCACATCCAAAAGACCGGTGGGACCACCTTCGGGAGACACCTGGTCCAAAATGTTCGACTGGAGCTTCCGTGTGATTGTAGACCGGGCCAGAAGAAGTGTACTTGCTACCGTCCGAACCGAAAGGAGACCTGGCTGTTCTCTCGGTTCTCCACCGGCTGGAGTTGCGGCTTACATGCGGACTGGACCGAGCTCACCAACTGCGTCCCGGGAGTTCTCAACAAAAAAGAGAGCAAGTCGAAAAAAATGAGAAAGTTCTACTACATCACTCTACTGAGGGACCCTGTTTCCCGCTATCTTAGCGAATGGAGGCACGTCCAGCGCGGGGCCACGTGGAAGACATCCCTGCACATGTGCGACGGACGGACTCCCACACCCGAAGAGTTGCCGCCCTGCTACGAGGGCACAGACTGGTCAGGGTGTACTTTGCAGCAGTTCATGGACTGCCCCTACAACCTAGCCAATAACCGCCAAGTGCGCATGCTGGCTGACCTTAGCCTGGTTGGCTGCTACAACCTCTCAACGGTCCCCGAGAAGAGGCGCTCACAGCTCCTACTCGAATCGGCCAAGAAAAATCTGCGAGACATGGCTTTCTTTGGCCTGACGGAGTTCCAGCGGAAGACGCAGTACTTGTTCGAGCGCACCTTCCACCTCAAGTTCATCCGGCCGTTCATGCAGTACAACAGCACGCGGGCGGCTGGCGTGGACCTGGATAACGGCACGATACAGCGCATCGAGGAGCTCAACGATCTGGATATGAAGCTGTATGACTACGCCAAAGACCTGTTTCAGCAGCGCTACCAGTACAAGCACATGTTAGACCGGCGGGAGCAGAGACTACTGAGAGGACAGGCGTCTTTCCACAGCCCGTTCCGAGAGGACGGAGTCGGGGGAGATGGTATGGCACGCCTGCCAACCGAGGACTACATGAACCACATCATTAATGGATGG

Function

symbol description
hs6st1a Enables heparan sulfate 6-O-sulfotransferase activity. Predicted to be involved in heparan sulfate proteoglycan biosynthetic process, enzymatic modification. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in several structures, including immature eye; nervous system; neural keel; neural tube; and polster. Human ortholog(s) of this gene implicated in hypogonadotropic hypogonadism 15 with or without anosmia. Orthologous to human HS6ST1 (heparan sulfate 6-O-sulfotransferase 1).
hs6st1b Predicted to enable heparan sulfate 6-O-sulfotransferase activity. Predicted to be involved in heparan sulfate proteoglycan biosynthetic process, enzymatic modification. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in several structures, including hindbrain neural keel; immature eye; nervous system; pancreatic bud; and presumptive floor plate. Human ortholog(s) of this gene implicated in hypogonadotropic hypogonadism 15 with or without anosmia. Orthologous to human HS6ST1 (heparan sulfate 6-O-sulfotransferase 1).
hs6st1 Predicted to enable heparan sulfate 6-O-sulfotransferase activity. Involved in neuron development. Predicted to be located in Golgi membrane. Predicted to be integral component of plasma membrane. Implicated in hypogonadotropic hypogonadism 15 with or without anosmia.

GO:

id name namespace
GO:0016232 HNK-1 sulfotransferase activity molecular_function

KEGG:

id description
K02514 HS6ST1; heparan sulfate 6-O-sulfotransferase HS6ST1

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000082_00847325_00903986.mRNA True 1221 mRNA 0.55 2 847325 903986

Neighbor

gene id symbol gene type direction distance location
CI01000082_00692849_00695595 NA coding downstream 151690 692771 ~ 695766 (-)
CI01000082_00691711_00692356 NA coding downstream 154969 691643 ~ 692356 (-)
CI01000082_00689066_00690051 NA coding downstream 157218 688512 ~ 690121 (-)
CI01000082_00678125_00678798 NA coding downstream 168486 677628 ~ 678839 (-)
CI01000082_00666387_00667509 NA coding downstream 179487 665937 ~ 667840 (-)
CI01000082_01040425_01063941 NA coding upstream 136254 1040240 ~ 1064660 (-)
CI01000082_01094334_01094888 BCL2A coding upstream 190348 1094334 ~ 1095207 (-)
CI01000082_01097596_01106806 NA coding upstream 193485 1097471 ~ 1106806 (-)
CI01000082_01113178_01153900 PRKAG2A, PRKAG2 coding upstream 209192 1113178 ~ 1153900 (-)
CI01000082_01164665_01166814 NA coding upstream 260488 1164474 ~ 1166814 (-)
G294858 NA non-coding downstream 125104 721999 ~ 722221 (-)
G294853 NA non-coding downstream 134253 711791 ~ 713072 (-)
G294847 NA non-coding downstream 141580 705406 ~ 705745 (-)
G294844 NA non-coding downstream 147459 699642 ~ 699866 (-)
G294842 NA non-coding downstream 149367 697748 ~ 697958 (-)
G295116 NA non-coding upstream 7087 911073 ~ 911284 (-)
G295143 NA non-coding upstream 61552 965538 ~ 965746 (-)
G295146 NA non-coding upstream 65618 969604 ~ 969842 (-)
G295163 NA non-coding upstream 285422 1189408 ~ 1190566 (-)
G295225 NA non-coding upstream 397760 1301746 ~ 1301947 (-)
G294821 NA other downstream 175863 670484 ~ 671462 (-)
CI01000082_00597462_00611609 ZMYND11 other downstream 235700 596319 ~ 611625 (-)
G296906 NA other upstream 1498833 2402819 ~ 2433912 (-)
CI01000082_02639529_02641582 NA other upstream 1734285 2638271 ~ 2641851 (-)
CI01000082_02829738_02840354 NA other upstream 1933216 2829738 ~ 2840354 (-)
CI01000082_03329243_03330818 NA other upstream 2425148 3329134 ~ 3332093 (-)
CI01000082_04002837_04008950 BRAFLDRAFT_115150, CDK5 other upstream 3103006 4001099 ~ 4009112 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_023522 hs6st1b coding NC_007135.7 CM002908.2 27783946 ~ 27879182 (-)
bowfin (Amia calva) AMCG00009114 hs6st1,hs6st1a,LOC107602601,LOC107588870,LOC107727332,LOC107748934,LOC107678693 coding CM030126.1 CM030126.1 26059541 ~ 26060656 (-)