CI01000082_01094334_01094888 (BCL2A)


Basic Information

Item Value
gene id CI01000082_01094334_01094888
gene name BCL2A
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000082
NCBI id null
chromosome length 5120761
location 1094334 ~ 1095207 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000082_01094334_01094888.mRNA
ATTCCTCGCGCCGAGCTTGGATCTTGACCGCGCGCGCTGCAGCAACGGCCAATCTATCTGTCAATCCATCATCAGGCGCGCGCTGGACATGCAGGTTTGCAGACAGTTATAGCTATAAAGTTATTATAACCAATGAATGTGATACTCAGTTATATTATTTTCCTCAAAAATTGCATTTCAATGAGAGAAATCACGTCAACGCGATGTGAATTTGAATTTTTCTGAGCCTTTCTCTGTGAGAGACTTTTTTTCCGTTACGATGTACTTCGAATAACCGACCATTTACTGCTCGCGCTCGTTTTTATCCTGTTTAATAACGATGGCCAACGAAATTCGCTATGACAATCGGAATATTGTGGAGAAATACCTCAATCACAAACTTTTAAAGAGGGGATATGTATGGAAACTTCAATCTACAGGGGAAGAAGATGACACCTTCAATAAAGGAGTAGAGGACTCCTCTCCAAACTCTGACAGGAGGCTTCAGGCTCCCTCAGCCGGCGGGGGTAACAACTCTGAATGCCTGATAGCCCACCGGCTCACCCGTTCAGACCCTCATTTGAGGCTCTACCGGGTGTTACGAGAGGCTGGAGACGAGATAGAAAGGATATACCAGCGTGAATTTGAGGAGATGTCCCACCAGATGTCATTCAGTCCCAATGTAGCGCAACGCAGCTTCTTAACCGTGGCTGAAGAGCTCTTTAGAGACGAGGTGAACTGGGGGCGGATCGTGGCTTTCTTCGAGTTTGGTGGGACCATGTGTGTGGAAAGCGTCAACCGGGAGATGGCGTCCCAGGTAGATAATATTGCACACTGGATGACAGACTACCTGAACGGGCCTCTGGAAAACTGGATCGAGGAAAATGGAGGTTGG

Function

symbol description
bcl2a Enables protein heterodimerization activity. Acts upstream of or within negative regulation of cysteine-type endopeptidase activity involved in apoptotic process. Predicted to be located in endoplasmic reticulum membrane; mitochondrion; and nuclear membrane. Predicted to be active in mitochondrial outer membrane. Is expressed in several structures, including anterior lateral mesoderm; corpuscles of Stannius; immature B cell; nervous system; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in several diseases, including Alzheimer's disease; carcinoma (multiple); hematologic cancer (multiple); intracranial aneurysm; and prostate cancer. Orthologous to human BCL2 (BCL2 apoptosis regulator).

GO:

id name namespace
GO:0008630 intrinsic apoptotic signaling pathway in response to DNA damage biological_process

KEGG:

id description
K02161 BCL2; apoptosis regulator Bcl-2

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000082_01094334_01094888.mRNA True 874 mRNA 0.47 1 1094334 1095207

Neighbor

gene id symbol gene type direction distance location
CI01000082_01040425_01063941 NA coding downstream 29674 1040240 ~ 1064660 (-)
CI01000082_00847325_00903986 HS6ST1B, HS6ST1, HS6ST1A coding downstream 190348 847325 ~ 903986 (-)
CI01000082_00692849_00695595 NA coding downstream 398699 692771 ~ 695766 (-)
CI01000082_00691711_00692356 NA coding downstream 401978 691643 ~ 692356 (-)
CI01000082_00689066_00690051 NA coding downstream 404227 688512 ~ 690121 (-)
CI01000082_01097596_01106806 NA coding upstream 2264 1097471 ~ 1106806 (-)
CI01000082_01113178_01153900 PRKAG2A, PRKAG2 coding upstream 17971 1113178 ~ 1153900 (-)
CI01000082_01164665_01166814 NA coding upstream 69267 1164474 ~ 1166814 (-)
CI01000082_01199588_01202126 NRROS coding upstream 104215 1199422 ~ 1203642 (-)
CI01000082_01211221_01216257 FBXO45 coding upstream 115329 1210536 ~ 1216493 (-)
G295146 NA non-coding downstream 124492 969604 ~ 969842 (-)
G295143 NA non-coding downstream 128588 965538 ~ 965746 (-)
G295116 NA non-coding downstream 183050 911073 ~ 911284 (-)
G294858 NA non-coding downstream 372113 721999 ~ 722221 (-)
G294853 NA non-coding downstream 381262 711791 ~ 713072 (-)
G295163 NA non-coding upstream 94201 1189408 ~ 1190566 (-)
G295225 NA non-coding upstream 206539 1301746 ~ 1301947 (-)
G295229 NA non-coding upstream 215085 1310292 ~ 1310536 (-)
G295237 NA non-coding upstream 225294 1320501 ~ 1320732 (-)
G295243 NA non-coding upstream 251752 1346959 ~ 1347268 (-)
CI01000082_00678125_00678798 NA other downstream 412028 677628 ~ 678839 (-)
G294821 NA other downstream 422872 670484 ~ 671462 (-)
CI01000082_00666387_00667509 NA other downstream 426494 665937 ~ 667840 (-)
CI01000082_00597462_00611609 ZMYND11 other downstream 482709 596319 ~ 611625 (-)
G296906 NA other upstream 1307612 2402819 ~ 2433912 (-)
CI01000082_02639529_02641582 NA other upstream 1543064 2638271 ~ 2641851 (-)
CI01000082_02829738_02840354 NA other upstream 1741995 2829738 ~ 2840354 (-)
CI01000082_03329243_03330818 NA other upstream 2233927 3329134 ~ 3332093 (-)
CI01000082_04002837_04008950 BRAFLDRAFT_115150, CDK5 other upstream 2911785 4001099 ~ 4009112 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_023525 bcl2a coding NC_007135.7 CM002908.2 28137210 ~ 28229618 (-)