CI01000082_02962536_02962848 (MMP16)


Basic Information

Item Value
gene id CI01000082_02962536_02962848
gene name MMP16
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000082
NCBI id null
chromosome length 5120761
location 2962488 ~ 2962848 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000082_02962536_02962848.mRNA
CATAAAAAACGTCACGCCTAAGGTGGGAGCGGAGGAGACCCACAACGCCATTCGCCGGGCGTTCGACGTGTGGCAGAACGTCACGCCGCTGCGTTTCGAGGCAGTGCCCTATAGTGACCTGGAGCGCAACAAGAAAGATGTGGATATTACTATCATTTTCGCCTCAGGTTTCCATGGCGACAGCTCCCCCTTTGATGGAGAAGGGGGTTTCCTTGCACATGCCTACTTTCCTGGTCCAGGGATTGGAGGAGATACACACTTTGATTCGGATGAGCCCTGGACACTAGGGAACCCTAACCATGACGGTATGTAAACCTGTTTATATTGGCTGTGTATAAACCCAGCTTTATTGGAGAATAAA

Function

symbol description
mmp16 Enables metalloaminopeptidase activity; metalloendopeptidase activity; and zinc ion binding activity. Involved in protein processing. Is integral component of plasma membrane.

GO: NA

KEGG:

id description
K07996 MMP16; matrix metalloproteinase-16 (membrane-inserted)

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000082_02962536_02962848.mRNA True 361 mRNA 0.51 1 2962488 2962848

Neighbor

gene id symbol gene type direction distance location
CI01000082_02927016_02952280 NA coding downstream 9822 2926572 ~ 2952666 (-)
CI01000082_02829738_02840354 NA coding downstream 122134 2829738 ~ 2840354 (-)
CI01000082_02819813_02826440 NA coding downstream 136048 2818780 ~ 2826440 (-)
CI01000082_02762419_02777589 ABCD3, ABCD3A coding downstream 184392 2761980 ~ 2778096 (-)
CI01000082_02750513_02759616 ACP5B coding downstream 201192 2750480 ~ 2761296 (-)
CI01000082_03069619_03074440 STEAP2 coding upstream 105459 3068307 ~ 3074871 (-)
CI01000082_03101028_03103698 NA coding upstream 138055 3100903 ~ 3103921 (-)
CI01000082_03127420_03132170 C1QL3, C1QL3A, C1QL3B coding upstream 164359 3127207 ~ 3132170 (-)
CI01000082_03136108_03172662 RSU1, RSU1.S coding upstream 172318 3135166 ~ 3172887 (-)
CI01000082_03175106_03183324 CUBN coding upstream 212069 3174917 ~ 3183324 (-)
G297058 NA non-coding downstream 40466 2915576 ~ 2922022 (-)
G297055 NA non-coding downstream 137794 2824417 ~ 2824694 (-)
G297047 NA non-coding downstream 147474 2814069 ~ 2815014 (-)
G297051 NA non-coding downstream 154684 2801293 ~ 2807804 (-)
G297043 NA non-coding downstream 200842 2761433 ~ 2761646 (-)
G297100 NA non-coding upstream 35402 2998250 ~ 3003174 (-)
G297170 NA non-coding upstream 269865 3232713 ~ 3235633 (-)
G297206 NA non-coding upstream 290525 3253373 ~ 3253721 (-)
G297243 NA non-coding upstream 341368 3304216 ~ 3307917 (-)
CI01000082_02639529_02641582 NA other downstream 320637 2638271 ~ 2641851 (-)
G296906 NA other downstream 528576 2402819 ~ 2433912 (-)
CI01000082_00689066_00690051 NA other downstream 2272054 688512 ~ 690121 (-)
G294821 NA other downstream 2291026 670484 ~ 671462 (-)
CI01000082_03329243_03330818 NA other upstream 366286 3329134 ~ 3332093 (-)
CI01000082_04002837_04008950 BRAFLDRAFT_115150, CDK5 other upstream 1044144 4001099 ~ 4009112 (-)
CI01000082_04332255_04333022 NA other upstream 1357662 4330173 ~ 4334359 (-)
CI01000082_04698358_04700580 NA other upstream 1735354 4697533 ~ 4700580 (-)

Expression


Co-expression Network