G295225



Basic Information


Item Value
gene id G295225
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000082
NCBI id null
chromosome length 5120761
location 1301746 ~ 1301947 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU335189
CTCAGACTCGCGCTCATGACTGCGCATGCGCATTGGCTGGTCTTGCATGAAAAACTTTTTTAAACGCTATTTGAATATAAGAAACAAGCTTTATGATACTGTTATTGTCAGATTCCATTTGTGTTTTTAAAAATTGAATTTAATCATAAGCTTAGTGAACAGTTTTGGAGCTGCACTTGGATGGGCTCCGACTAAATACAAG

Function


NR:

description
centrosomal protein of 97 kDa-like isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU335189 True 202 lncRNA 0.37 1 1301746 1301947

Neighbor


gene id symbol gene type direction distance location
CI01000082_01230554_01235723 NA coding downstream 66007 1229514 ~ 1235739 (-)
CI01000082_01211221_01216257 FBXO45 coding downstream 85253 1210536 ~ 1216493 (-)
CI01000082_01199588_01202126 NRROS coding downstream 98104 1199422 ~ 1203642 (-)
CI01000082_01164665_01166814 NA coding downstream 134932 1164474 ~ 1166814 (-)
CI01000082_01113178_01153900 PRKAG2A, PRKAG2 coding downstream 147846 1113178 ~ 1153900 (-)
CI01000082_01330784_01334768 OLFM3, OLFM3A coding upstream 28306 1330253 ~ 1335190 (-)
CI01000082_01372750_01454491 COL11A1 coding upstream 70451 1372398 ~ 1456520 (-)
CI01000082_01490700_01492559 NA coding upstream 188705 1490652 ~ 1492559 (-)
CI01000082_01680942_01689756 NA coding upstream 378844 1680791 ~ 1690021 (-)
CI01000082_01796282_01837217 VAV3 coding upstream 494289 1796236 ~ 1837547 (-)
G295163 NA non-coding downstream 111180 1189408 ~ 1190566 (-)
G295146 NA non-coding downstream 331904 969604 ~ 969842 (-)
G295143 NA non-coding downstream 336000 965538 ~ 965746 (-)
G295116 NA non-coding downstream 390462 911073 ~ 911284 (-)
G294858 NA non-coding downstream 579525 721999 ~ 722221 (-)
G295229 NA non-coding upstream 8345 1310292 ~ 1310536 (-)
G295237 NA non-coding upstream 18554 1320501 ~ 1320732 (-)
G295243 NA non-coding upstream 45012 1346959 ~ 1347268 (-)
G295261 NA non-coding upstream 110673 1412620 ~ 1413188 (-)
G295274 NA non-coding upstream 157748 1459695 ~ 1459908 (-)
CI01000082_00689066_00690051 NA other downstream 611312 688512 ~ 690121 (-)
CI01000082_00678125_00678798 NA other downstream 619440 677628 ~ 678839 (-)
G294821 NA other downstream 630284 670484 ~ 671462 (-)
CI01000082_00666387_00667509 NA other downstream 633906 665937 ~ 667840 (-)
CI01000082_00597462_00611609 ZMYND11 other downstream 690121 596319 ~ 611625 (-)
G296906 NA other upstream 1100872 2402819 ~ 2433912 (-)
CI01000082_02639529_02641582 NA other upstream 1336324 2638271 ~ 2641851 (-)
CI01000082_02829738_02840354 NA other upstream 1535255 2829738 ~ 2840354 (-)
CI01000082_03329243_03330818 NA other upstream 2027187 3329134 ~ 3332093 (-)
CI01000082_04002837_04008950 BRAFLDRAFT_115150, CDK5 other upstream 2705045 4001099 ~ 4009112 (-)

Expression



Co-expression Network