G296934


Basic Information

Item Value
gene id G296934
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000082
NCBI id null
chromosome length 5120761
location 2466499 ~ 2466891 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU337098
TTTATTAATATGCAAGTCCATAAGTGTGCAATTACAGATAAGTACATATTACAATACGTAAGTAGGCTTACAGATAAGTATACATTATTAGGCAAAAAATTAGATAATTAGATCAGTGGTATGAAACATATTCAGATAAATCAATGTAAGAATCTGAATGTTACTTTTTGTCACACTTTAACCCGATATATATATATATATATATATATATATATATATATCATCTAACATAAGTTTGTAAATACACACATACATACACACATTATATTTACAAACTTTTATGTTAGATGTGATTAATCGCGATTATATTAGATTACATAACATTACTGTTGTCAAATCGATTCATTGTGATTTATCGCATCTAACATAAGTTTGCAAATATACACACATTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU337098 True 393 lncRNA 0.25 1 2466499 2466891

Neighbor

gene id symbol gene type direction distance location
CI01000082_02449770_02454344 NA coding downstream 10953 2449743 ~ 2455546 (-)
CI01000082_02295379_02298949 NA coding downstream 167175 2295142 ~ 2299324 (-)
CI01000082_02175270_02187098 SNX7 coding downstream 278333 2175227 ~ 2188166 (-)
CI01000082_02172392_02173323 NA coding downstream 292917 2172378 ~ 2173582 (-)
CI01000082_02065074_02095249 PLPPR4, LPPR4 coding downstream 371224 2064261 ~ 2095275 (-)
CI01000082_02499101_02514104 PTBP2, PTBP2A coding upstream 31715 2498606 ~ 2514104 (-)
CI01000082_02639529_02641582 NA coding upstream 172176 2638271 ~ 2641851 (-)
CI01000082_02648283_02668024 TMEM56, TMEM56A coding upstream 179897 2646788 ~ 2668024 (-)
CI01000082_02686245_02689228 CNN3B, CNN3A, CNN3 coding upstream 218485 2685376 ~ 2689228 (-)
CI01000082_02716435_02737089 NA coding upstream 249174 2716065 ~ 2737473 (-)
G296824 NA non-coding downstream 231966 2233790 ~ 2234533 (-)
G296820 NA non-coding downstream 235301 2226775 ~ 2231198 (-)
G296775 NA non-coding downstream 371546 2094722 ~ 2094953 (-)
G296773 NA non-coding downstream 372441 2093784 ~ 2094058 (-)
G296763 NA non-coding downstream 408364 2057726 ~ 2058135 (-)
G296937 NA non-coding upstream 11099 2477990 ~ 2478222 (-)
G296939 NA non-coding upstream 13020 2479911 ~ 2480129 (-)
G296943 NA non-coding upstream 17700 2484591 ~ 2484794 (-)
G296958 NA non-coding upstream 19601 2486492 ~ 2486718 (-)
G296960 NA non-coding upstream 21332 2488223 ~ 2488515 (-)
G296906 NA other downstream 32587 2402819 ~ 2433912 (-)
CI01000082_00689066_00690051 NA other downstream 1776065 688512 ~ 690121 (-)
CI01000082_00678125_00678798 NA other downstream 1784193 677628 ~ 678839 (-)
G294821 NA other downstream 1795037 670484 ~ 671462 (-)
CI01000082_00666387_00667509 NA other downstream 1798659 665937 ~ 667840 (-)
CI01000082_02829738_02840354 NA other upstream 370311 2829738 ~ 2840354 (-)
CI01000082_03329243_03330818 NA other upstream 862243 3329134 ~ 3332093 (-)
CI01000082_04002837_04008950 BRAFLDRAFT_115150, CDK5 other upstream 1540101 4001099 ~ 4009112 (-)
CI01000082_04332255_04333022 NA other upstream 1853619 4330173 ~ 4334359 (-)

Expression


Co-expression Network