G297051


Basic Information

Item Value
gene id G297051
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000082
NCBI id null
chromosome length 5120761
location 2801293 ~ 2807804 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU337225
AGCCTCCCATGATATAGTCTAGAAAGGTGTATTCCCTGGTAATCTGACAAACTTTCACACTCACTACTCCAGAGTTCTTATAATTTTTTTTCTTCTGTTTCTTCTTACTGTTTACACAGTCAAACTCGGCTGGAGCGCTGCGGGTGGCCTCTTGAAGACGCTTCATAGTGGTCTCAAAAATCCCAATCAAATCATGAGATCCATCGTTGTCATAATCGTAACATTCAACCTTAATTGGTTTGTCCATGTCCCCTGCACAGAGAGACCGCAGAGGGATTTTAAAAGGCCTCCAGCAAGGATTCAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU337225 True 305 lncRNA 0.43 4 2801293 2807804

Neighbor

gene id symbol gene type direction distance location
CI01000082_02762419_02777589 ABCD3, ABCD3A coding downstream 23197 2761980 ~ 2778096 (-)
CI01000082_02750513_02759616 ACP5B coding downstream 39997 2750480 ~ 2761296 (-)
CI01000082_02716435_02737089 NA coding downstream 63820 2716065 ~ 2737473 (-)
CI01000082_02686245_02689228 CNN3B, CNN3A, CNN3 coding downstream 112065 2685376 ~ 2689228 (-)
CI01000082_02648283_02668024 TMEM56, TMEM56A coding downstream 133269 2646788 ~ 2668024 (-)
CI01000082_02819813_02826440 NA coding upstream 10976 2818780 ~ 2826440 (-)
CI01000082_02829738_02840354 NA coding upstream 21934 2829738 ~ 2840354 (-)
CI01000082_02927016_02952280 NA coding upstream 118768 2926572 ~ 2952666 (-)
CI01000082_02962536_02962848 MMP16 coding upstream 154684 2962488 ~ 2962848 (-)
CI01000082_03069619_03074440 STEAP2 coding upstream 260503 3068307 ~ 3074871 (-)
G297043 NA non-coding downstream 39647 2761433 ~ 2761646 (-)
G296951 NA non-coding downstream 53363 2743616 ~ 2747930 (-)
G297017 NA non-coding downstream 156111 2644846 ~ 2645182 (-)
G296982 NA non-coding downstream 266222 2534850 ~ 2535071 (-)
G296974 NA non-coding downstream 271406 2529433 ~ 2529887 (-)
G297047 NA non-coding upstream 6265 2814069 ~ 2815014 (-)
G297055 NA non-coding upstream 16613 2824417 ~ 2824694 (-)
G297058 NA non-coding upstream 107772 2915576 ~ 2922022 (-)
G297100 NA non-coding upstream 190446 2998250 ~ 3003174 (-)
CI01000082_03136108_03172662 RSU1, RSU1.S non-coding upstream 364639 3135166 ~ 3172887 (-)
CI01000082_02639529_02641582 NA other downstream 159442 2638271 ~ 2641851 (-)
G296906 NA other downstream 367381 2402819 ~ 2433912 (-)
CI01000082_00689066_00690051 NA other downstream 2110859 688512 ~ 690121 (-)
G294821 NA other downstream 2129831 670484 ~ 671462 (-)
CI01000082_00666387_00667509 NA other downstream 2133453 665937 ~ 667840 (-)
CI01000082_03329243_03330818 NA other upstream 521330 3329134 ~ 3332093 (-)
CI01000082_04002837_04008950 BRAFLDRAFT_115150, CDK5 other upstream 1199188 4001099 ~ 4009112 (-)
CI01000082_04332255_04333022 NA other upstream 1512706 4330173 ~ 4334359 (-)
CI01000082_04698358_04700580 NA other upstream 1890398 4697533 ~ 4700580 (-)

Expression


Co-expression Network