G299266


Basic Information

Item Value
gene id G299266
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000086
NCBI id null
chromosome length 2920448
location 1002265 ~ 1002619 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU339724
AGGATGAGGTGCCAAGGAGACAAGGAGTCTCAGATGAAATTCGTGCCACTAGTTGACCATGTCCTTGTCCGTGGTATGACTATGAGGGAGGCTGGGCAATGAGTTCAGCCAAACTTAAGTTGCTTCACCATCGCCTCGATCATGAGAACCTTCAGGGAGGAAAACAGGACACAGAGACGATGGAATGGAAGAAGCCTGACTAGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU339724 True 205 lncRNA 0.50 2 1002265 1002619

Neighbor

gene id symbol gene type direction distance location
CI01000086_00978789_00999074 NA coding downstream 2525 978540 ~ 999740 (-)
CI01000086_00949574_00963179 NA coding downstream 39005 948026 ~ 963260 (-)
CI01000086_00935341_00936321 NA coding downstream 63077 935052 ~ 939188 (-)
CI01000086_00587995_00596565 BRAFLDRAFT_115002, ETFB, ETFB.L coding downstream 405526 587765 ~ 596739 (-)
CI01000086_00582697_00586449 VSIG10L coding downstream 415816 582697 ~ 586449 (-)
CI01000086_01005334_01006342 NA coding upstream 1965 1004584 ~ 1006342 (-)
CI01000086_01069219_01094068 AGO3, EIF2C3, I2C3 coding upstream 66388 1061523 ~ 1094251 (-)
CI01000086_01101333_01138683 NA coding upstream 98141 1100760 ~ 1138683 (-)
CI01000086_01193934_01219331 NA coding upstream 191096 1193715 ~ 1219440 (-)
CI01000086_01237966_01253245 NA coding upstream 235292 1237911 ~ 1253288 (-)
G299221 NA non-coding downstream 126097 853604 ~ 876168 (-)
G299218 NA non-coding downstream 158086 843740 ~ 844179 (-)
G299096 NA non-coding downstream 275872 694096 ~ 726393 (-)
G299049 NA non-coding downstream 369939 629721 ~ 632326 (-)
CI01000086_00394709_00423259 NA non-coding downstream 567714 393499 ~ 423259 (-)
G299119 NA non-coding upstream 33417 1036036 ~ 1044620 (-)
G299128 NA non-coding upstream 56385 1059004 ~ 1060093 (-)
G299283 NA non-coding upstream 175198 1177817 ~ 1237208 (-)
G299299 NA non-coding upstream 226302 1228921 ~ 1231136 (-)
G299173 NA other downstream 234386 765617 ~ 767879 (-)
G298872 NA other downstream 465955 535023 ~ 536310 (-)
G299107 NA other upstream 73527 1126738 ~ 1126798 (-)
CI01000086_01257926_01260025 SERPINB1L4, SERPINB14 other upstream 256395 1257926 ~ 1260025 (-)
G299528 NA other upstream 665587 1668206 ~ 1695177 (-)
CI01000086_01852638_01897719 UBR5 other upstream 891295 1852146 ~ 1897719 (-)
CI01000086_02366362_02373059 SLC6A20 other upstream 1361712 2364331 ~ 2373059 (-)

Expression


Co-expression Network