G299351



Basic Information


Item Value
gene id G299351
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000086
NCBI id null
chromosome length 2920448
location 1409538 ~ 1409853 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU339835
CGCCATCTTTATGTAGAGCAACAATTCTCTTTTTCAGATCCTCAGAGAGTTCTTTGCCATGAGGTGCCATGTTGAACTTCCAGTGACCAGTATGAGAGAGTGAGAGCGATAACACCAAATTTAACACACCTGCTCCCCATTCACACCTGAGACCTTGTAACACTAACGAGTCACATGACACCGGGGAGAGAAAATGGCTAATTGGGCCCAATTTGGACATTTGCACTTAGGGGTGTACTCACTTTTGTGGCCAGCGGTTTAGGCATTAATGGCTGTGTTGAGTTATTTTGAGGGGACAGCAAATTTACACTGTTAT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU339835 True 316 lncRNA 0.45 1 1409538 1409853

Neighbor


gene id symbol gene type direction distance location
CI01000086_01313364_01320865 NA coding downstream 87524 1313022 ~ 1322014 (-)
CI01000086_01296658_01297947 NA coding downstream 111479 1295830 ~ 1298059 (-)
CI01000086_01257926_01260025 SERPINB1L4, SERPINB14 coding downstream 149513 1257926 ~ 1260025 (-)
CI01000086_01237966_01253245 NA coding downstream 156250 1237911 ~ 1253288 (-)
CI01000086_01193934_01219331 NA coding downstream 190098 1193715 ~ 1219440 (-)
CI01000086_01670242_01672517 NA coding upstream 259935 1669788 ~ 1674496 (-)
CI01000086_01852638_01897719 UBR5 coding upstream 442293 1852146 ~ 1897719 (-)
CI01000086_01915013_01921794 AZIN1A coding upstream 505160 1915013 ~ 1921794 (-)
CI01000086_01948087_01983560 SPIRE1 coding upstream 538154 1948007 ~ 1983560 (-)
CI01000086_01994840_02008387 TPPP coding upstream 584742 1994595 ~ 2008387 (-)
G299348 NA non-coding downstream 5278 1403687 ~ 1404260 (-)
G299345 NA non-coding downstream 8257 1400935 ~ 1401281 (-)
G299323 NA non-coding downstream 24038 1381191 ~ 1385500 (-)
G299322 NA non-coding downstream 36349 1371011 ~ 1373189 (-)
G299321 NA non-coding downstream 55189 1353406 ~ 1354349 (-)
G299373 NA non-coding upstream 23952 1433805 ~ 1435707 (-)
G299394 NA non-coding upstream 53191 1463044 ~ 1463405 (-)
G299414 NA non-coding upstream 85318 1495171 ~ 1495919 (-)
G299435 NA non-coding upstream 127962 1537815 ~ 1538927 (-)
G299437 NA non-coding upstream 130990 1540843 ~ 1544165 (-)
G299107 NA other downstream 282740 1126738 ~ 1126798 (-)
G299173 NA other downstream 641659 765617 ~ 767879 (-)
CI01000086_00587995_00596565 BRAFLDRAFT_115002, ETFB, ETFB.L other downstream 812909 587765 ~ 596739 (-)
G298872 NA other downstream 873228 535023 ~ 536310 (-)
G299528 NA other upstream 258353 1668206 ~ 1695177 (-)
CI01000086_02366362_02373059 SLC6A20 other upstream 954478 2364331 ~ 2373059 (-)
G299598 NA other upstream 1455829 2865682 ~ 2868103 (-)

Expression



Co-expression Network