G298574


Basic Information

Item Value
gene id G298574
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000086
NCBI id null
chromosome length 2920448
location 1937608 ~ 1939310 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU338974
CGCGGATCACAGCAGTCGATCAGCTGACCGTGAGTGAAGCCTTTGGAAAGAGTGTAGTGTCATAATGAATATCAAATCCTAAGACTGATCCTTTGAAAGGTATTTAATTAAAACTACCAAATAATCGTCGTGTCATCTCGTTCACGTTAAGACTCTTCAGTACTTGTTCCTCAGCAGCCATGACAGAGTTCTGGTTGATTTCGGCTCCTGGAGAGAAAACCTGCCAGCAGACATGGGACAAACTAATGACTGCCACAACTCGCACCAACAATCTGTCCACTAACAACAAGTTCAACATTCCTGATCTCAAGGTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU338974 True 314 lncRNA 0.44 2 1937608 1939310

Neighbor

gene id symbol gene type direction distance location
CI01000086_01909580_01912644 NA coding upstream 23923 1909580 ~ 1913685 (+)
CI01000086_01847624_01849735 NA coding upstream 87694 1846841 ~ 1849914 (+)
CI01000086_01838372_01840689 FABP10A coding upstream 96905 1838272 ~ 1840703 (+)
CI01000086_01779573_01833077 MYOM3 coding upstream 104531 1779573 ~ 1833077 (+)
CI01000086_01721518_01734414 NA coding upstream 202898 1721518 ~ 1734710 (+)
CI01000086_01984915_01990542 NA coding downstream 45605 1984915 ~ 1991154 (+)
CI01000086_02013500_02015770 NA coding downstream 73658 2012968 ~ 2016050 (+)
CI01000086_02045752_02053397 TRIP13 coding downstream 106442 2045752 ~ 2053710 (+)
CI01000086_02067516_02068077 NA coding downstream 126853 2066163 ~ 2070185 (+)
CI01000086_02104570_02112682 NA coding downstream 165260 2104570 ~ 2112808 (+)
G298565 NA non-coding upstream 38927 1894901 ~ 1898681 (+)
G298559 NA non-coding upstream 58171 1878274 ~ 1879437 (+)
G298520 NA non-coding upstream 69578 1865275 ~ 1868030 (+)
G298557 NA non-coding upstream 95477 1841618 ~ 1842131 (+)
G298546 NA non-coding upstream 133716 1802862 ~ 1803892 (+)
G298602 NA non-coding downstream 25743 1965053 ~ 1983646 (+)
G298642 NA non-coding downstream 79243 2018553 ~ 2019317 (+)
G298601 NA non-coding downstream 122906 2062216 ~ 2064301 (+)
G298656 NA non-coding downstream 174573 2113883 ~ 2114169 (+)
G298611 NA non-coding downstream 313806 2253116 ~ 2321680 (+)
G298529 NA other upstream 56155 1876890 ~ 1881453 (+)
G298381 NA other upstream 760692 1172156 ~ 1176916 (+)
CI01000086_01150842_01165271 DHDDS other upstream 771686 1150842 ~ 1165922 (+)
G298366 NA other upstream 789741 1136660 ~ 1147867 (+)
G298208 NA other upstream 957498 947191 ~ 980110 (+)
CI01000086_02807666_02845401 PHLDB3, ETHE1 other downstream 868273 2806368 ~ 2845762 (+)

Expression


Co-expression Network