G298596


Basic Information

Item Value
gene id G298596
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000086
NCBI id null
chromosome length 2920448
location 2330579 ~ 2331759 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU338996
CGCGTAGAAACCGCTGGAGGGACACGAGCAGCAGCAGAGAGACTAAATGAAACGAATTCACTGAATCAGAAAGGTGTCCACTACACGGGCGGACCGCAACATCAGCTCATGTTCAAAAGGAAGCCTGTCGCGCGACACAAACCGAGTCAGGCTACGTGGAGAATGGAGATCATTGTGTTTGTCAAAGCCATTCATGGAACAAATCCATTGAAATGAAAAGGGATAGTCAACCAGCCGTCCACCAACTGACTAGGTGTATAGAGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU338996 True 265 lncRNA 0.49 2 2330579 2331759

Neighbor

gene id symbol gene type direction distance location
CI01000086_02310487_02314131 RBM24B, RBM24 coding upstream 16432 2309348 ~ 2314147 (+)
CI01000086_02266795_02305843 KIF13A coding upstream 24590 2266795 ~ 2305989 (+)
CI01000086_02226264_02227472 NA coding upstream 102954 2225543 ~ 2227625 (+)
CI01000086_02203506_02218668 PTDSS1B, PTDSS1, PTDSS1A coding upstream 111894 2203023 ~ 2218685 (+)
CI01000086_02152113_02180258 PLEKHG4B coding upstream 150321 2152113 ~ 2180258 (+)
CI01000086_02335074_02346679 SACM1L.L, SACM1LB, SACM1L, SACM1LA coding downstream 3315 2335074 ~ 2346920 (+)
CI01000086_02381193_02384764 NA coding downstream 49434 2381193 ~ 2385128 (+)
CI01000086_02387094_02397102 NOD1 coding downstream 55335 2387094 ~ 2397145 (+)
CI01000086_02741241_02763692 XRCC1 coding downstream 408897 2740656 ~ 2764358 (+)
CI01000086_02773589_02785090 DRD2L coding downstream 441830 2773589 ~ 2785122 (+)
G298577 NA non-coding upstream 4854 2322896 ~ 2325725 (+)
G298611 NA non-coding upstream 8899 2253116 ~ 2321680 (+)
G298656 NA non-coding upstream 216410 2113883 ~ 2114169 (+)
G298601 NA non-coding upstream 266278 2062216 ~ 2064301 (+)
G298642 NA non-coding upstream 311262 2018553 ~ 2019317 (+)
G298676 NA non-coding downstream 83623 2415382 ~ 2417816 (+)
G298694 NA non-coding downstream 125564 2457323 ~ 2457531 (+)
G298706 NA non-coding downstream 214957 2546716 ~ 2549968 (+)
G298743 NA non-coding downstream 278807 2610566 ~ 2610887 (+)
G298744 NA non-coding downstream 281234 2612993 ~ 2693507 (+)
G298529 NA other upstream 449126 1876890 ~ 1881453 (+)
G298381 NA other upstream 1153663 1172156 ~ 1176916 (+)
CI01000086_01150842_01165271 DHDDS other upstream 1164657 1150842 ~ 1165922 (+)
G298366 NA other upstream 1182712 1136660 ~ 1147867 (+)
G298208 NA other upstream 1350469 947191 ~ 980110 (+)
CI01000086_02807666_02845401 PHLDB3, ETHE1 other downstream 475824 2806368 ~ 2845762 (+)

Expression


Co-expression Network