G299739


Basic Information

Item Value
gene id G299739
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000086
NCBI id null
chromosome length 2920448
location 2463501 ~ 2463712 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU340302
GATTTAGACATCCAAACAAGACCAGCAAACAATACTGAACTCTCAGGAGATGTGGAGCTCAGAGATTTTTAGACTATAAACATTTTTTGTATGACTGCTGATGTTACAGCATATAAATGCTCGCTGGTTAATTTCATTTGTCTACTAAAAATGTCAAAATGTGGACATACATGATCAGATCACTCTGACAGTTTTGTAATATTTTTCTGAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU340302 True 212 lncRNA 0.34 1 2463501 2463712

Neighbor

gene id symbol gene type direction distance location
CI01000086_02403053_02403317 ZNRF2 coding downstream 60184 2402872 ~ 2403317 (-)
CI01000086_02400288_02400580 NA coding downstream 62893 2399858 ~ 2400608 (-)
CI01000086_02366362_02373059 SLC6A20 coding downstream 90442 2364331 ~ 2373059 (-)
CI01000086_02192695_02193522 NA coding downstream 269735 2192635 ~ 2193766 (-)
CI01000086_02032793_02044182 BRD9 coding downstream 419319 2032712 ~ 2044182 (-)
CI01000086_02543856_02545475 FZD1, FZD1.L coding upstream 78656 2542368 ~ 2545808 (-)
CI01000086_02610598_02642920 CDK14 coding upstream 146855 2610567 ~ 2642920 (-)
CI01000086_02886112_02888612 KDF1A coding upstream 421735 2885447 ~ 2890213 (-)
CI01000086_02893723_02895660 NA coding upstream 429709 2893421 ~ 2895833 (-)
CI01000086_02897831_02901375 TMEM222, TMEM222A, TMEM222B coding upstream 434092 2897804 ~ 2901375 (-)
G299734 NA non-coding downstream 6161 2457127 ~ 2457340 (-)
G299606 NA non-coding downstream 78337 2381035 ~ 2385164 (-)
G299616 NA non-coding downstream 112218 2346302 ~ 2351283 (-)
G299718 NA non-coding downstream 129259 2334009 ~ 2334242 (-)
G299717 NA non-coding downstream 129961 2333275 ~ 2333540 (-)
G299765 NA non-coding upstream 37420 2501132 ~ 2501412 (-)
G299766 NA non-coding upstream 37716 2501428 ~ 2501664 (-)
G299770 NA non-coding upstream 42478 2506190 ~ 2511270 (-)
G299609 NA non-coding upstream 83871 2547583 ~ 2606396 (-)
G299803 NA non-coding upstream 187301 2651013 ~ 2694979 (-)
CI01000086_01852638_01897719 UBR5 other downstream 560082 1852146 ~ 1897719 (-)
G299528 NA other downstream 768324 1668206 ~ 1695177 (-)
CI01000086_01257926_01260025 SERPINB1L4, SERPINB14 other downstream 1202264 1257926 ~ 1260025 (-)
G299107 NA other downstream 1336703 1126738 ~ 1126798 (-)
G299598 NA other upstream 401970 2865682 ~ 2868103 (-)

Expression


Co-expression Network