G303620


Basic Information

Item Value
gene id G303620
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 857076 ~ 857313 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU344967
CAAAAATTAAAATCTGGCCCTTTAAAGTAGTCAGTAGTAGACTGGACTTTTCCAAATATTCCCTTGTGAAAATAGTGCACTTTTCCATTATAGGAAAAATAGCAGCCGGAACATTGTGCTACAGATTTCCTTTTGTGTTCCATGCACTGAAGAAAGAAAGTCATACAAGTTTGTGAAATCTTTCCTACCTGGTTGCCTTCTCCCCCCAAAAAAGTTCTGTTAAAGCTCTTGTATTTGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU344967 True 238 lncRNA 0.37 1 857076 857313

Neighbor

gene id symbol gene type direction distance location
CI01000092_00779993_00785442 NA coding upstream 71634 779932 ~ 785442 (+)
CI01000092_00759626_00765910 LHFP coding upstream 90697 759626 ~ 766379 (+)
CI01000092_00658637_00661404 LHFP, LHFPL1 coding upstream 195672 658637 ~ 661404 (+)
CI01000092_00566301_00571771 NA coding upstream 284464 566165 ~ 573256 (+)
CI01000092_00433410_00477493 FOXO1, FOXO1A coding upstream 379570 432638 ~ 477506 (+)
CI01000092_00868568_00868858 NA coding downstream 10717 868030 ~ 869072 (+)
CI01000092_00869289_00871464 NA coding downstream 11861 869174 ~ 871841 (+)
CI01000092_00887219_00908525 NA coding downstream 29906 887219 ~ 908525 (+)
CI01000092_00964013_00967452 NA coding downstream 106574 963887 ~ 980369 (+)
CI01000092_01034513_01049419 MAML2 coding downstream 177200 1034513 ~ 1049419 (+)
G303618 NA non-coding upstream 1628 855152 ~ 855448 (+)
G303496 NA non-coding upstream 208456 627751 ~ 648620 (+)
G303542 NA non-coding upstream 279624 576684 ~ 577452 (+)
G303537 NA non-coding upstream 290969 565636 ~ 566107 (+)
G303621 NA non-coding downstream 923 858236 ~ 863315 (+)
G303592 NA non-coding downstream 52624 909937 ~ 910307 (+)
G303659 NA non-coding downstream 205841 1063154 ~ 1063471 (+)
G303768 NA other downstream 458130 1315443 ~ 1316523 (+)
G304938 NA other downstream 1460479 2317792 ~ 2318234 (+)
G305584 NA other downstream 2809995 3667308 ~ 3667965 (+)
G305596 NA other downstream 2869034 3726347 ~ 3863135 (+)

Expression


Co-expression Network